Comments

  1. Nick Gotts (formerly KG) says

    Owlmirror,

    I think I could tentatively posit that if the “system” running the scientific method became pathological, the scientific method running on that pathological system would not work

    Since that sort of pathology is exactly what I’m talking about, I’m not sure why you’re arguing.

    With regard to the sort algorithm, if you can’t use it because data swaps itself at random, that means it doesn’t work, even though (and this contrasts with the scientific method as you defined it) it is logically necessary that if you could implement it successfully, it always would.

    Why wouldn’t the same be the case, by analogy, for the scientific method? I mean, I’m using “method” analogously to “algorithm”.

    Because the scientific method is not an algorithm.

    And I think a more rigorous case could be made that the scientific method is basically an algorithm; an interactive proof-system.

    “Basically” here is a weasel word: as you’ve described it, and in reality, the scientific method is not invariably truth-preserving.

    As I recall, you’ve argued that science does prove things — you haven’t changed your mind on that, have you?

    Every time I’ve said that, I’ve made clear that it proves things in the same sense that we use in legal contexts or everyday life, not in the sense it is used in logic and mathematics.

  2. Q.E.D says

    Breaking News: Stonewall UK names Scottish cardinal Bigot of the Year and how I fucking hate accommodationists.

    Stonewall UK has named Cardinal O’Brien “Bigot of the Year” for his relentless, outspoken calumnies against gay people and gay marriage.

    Predictably everyone is scolding Stonewall for not taking a more accomodationist stance. Sponsors are threatening to yank funding.

    What O’Brien said:

    gay marriage is a “grotesque subversion of a universally accepted human right”. Gay relationships are “harmful to the physical, mental and spiritual wellbeing”.

    He then started a defense of marriage type group to politically oppose gay rights in Scotland. When it was pointed out to him that gay marriage did no harm to him and no one was asking him to perform any, he compared the existence of gay marriage to the existence of slavery (i.e., it’s very existence is repugnant and must be fought)

    Apparently we live in a society that tolerates the most outrageous bigotry as long as it is religiously motivated. And then, and fucking then, shushes people who call it out loud.

    Accomodationists work hand in hand with the religious to preserve their privilege and keep their bigotry beyond reproach in polite society.

    Source here

  4. anteprepro says

    Apparently we live in a society that tolerates the most outrageous bigotry as long as it is religiously motivated. And then, and fucking then, shushes people who call it out loud.

    I’ll let Will Smith explain my initial reaction.

    As for my serious reaction: Fuck those fuckers. Double standards, especially ones that entail turning a blind eye to bigotry and opposing people who stand up to that bigotry, piss me off to no end. Really, it is the clearest illustration with what is wrong with religious “moderates”. Hell, it is what is wrong with political “moderates”. They are perfectly silent until someone without privileges is mean enough to “sink to the level” that the assholes with privileges have been operating at the whole time. And then, suddenly, outrage and tolerance of intolerance and JUST AS BAD and why can’t we all just get along. Too bad these ubiquitous self-appointed mediators never show up until someone has the gumption to fucking fight back. When its just one-sided bullying, it apparently isn’t interesting enough for them to give a fuck. They only care when they can tut-tut BOTH SIDES. Otherwise, who cares, amirite?

  5. jonmilne says

    Hi guys, more help needed on an email debate. This time it’s with a YEC, and only now (after three emails from him) has he actually come up with some actual “evidence” for his claims. I’m splitting the email into three parts for easier reading. Here’s the first part:

    Evolutionists tend to be fraught with “selection and elimination” examples that only put their positions in a bad light by ignoring the seminal evidence supporting the Noahic Flood and hence YEC. The Green River Shale formation is replete with fully preserved fossilized fish (especially catfish), right down to scales, eyes and other intricate detail. To avoid rot and disintegration, they would have had to have been rapidly buried. Some evolutionists have tried to counter that the alkaline condition would preserve them, but alkaline doesn’t work that way at all (CMI’s Tas Walker even commented that alkaline powder’s disintegrative properties is why it is used in dishwashers (http://biblicalgeology.net/General/QA-Topics.html), and even if that dubious statement were true, there is the further problem of avoiding scavengers, which in that hostile environment would be impossible.

    As Paul Garner points out in his Answers in Genesis article, “Green River Blues,” (http://www/answersingenesis.org/articles/cm/v19/n3/green-river-blues) among the fossils are those from the extinct shorebird Presbyornis. In stating his case against an old age earth, he writes: “The Presbyornis fossils are even more problematic. Birds have hollow bones that tend not to preserve well in the fossil record. How were these bird bones protected from scavenging and decay for thousands of years until a sufficient numberof the fine annual layers had built up to bury them? ‘Enormous concentrations’ of bird bones are a clear indication that something is seriously wrong with the idea of slow accumulation. Instead, such fossils support the notion of rapid burial.” Garner’s article is well footnoted, and references include evolutionist articles as well as creationist.

    As stated by ICR’s John D. Morris, few serious scientists entertain that varves are merely annual events, as bottom-hugging density flows pervade in geologic strata: “In many field observations and in laboratory experiments, multiple laminae can form almost instantaneously in simulated bottom-hugging density flows, now widely recognized as frequent throughout the geologic strata. Few knowledgeable geologists now cling to the myth of one varve equals one year.” (Morris, J. 2007. Varves: Proof for an Old Earth? Acts & Facts: 36(10): 13; http://www.icr.org/article/varves-proof-for-old-earth/) Within that article, he also validly points out the plethora of fossilized species both flora and fauna that present in the formation that are from varied habitats and could only have been washed there but a powerful cataclysm, such as bird fossils “from shorebirds to forest dwellers to ocean feeders.” There are also reptile samples from various locations as well as plants representing upland to sub-tropical species. For much the same discourse and further discussion, see also Morris’s article, “Do Millions of Laminae in the Green River Shales Document Millions of Years?” (http://www.icr.org/article/do-laminae-green-river-shales-document-millions-years/) One of his points there is that one study showed that the laminae varied in occurence by 35% between two instantaneous volcanic ash falls.

    Your comments concerning the indications of more pollen in varves in the upper part of the dark layer representing spring shows a basic misunderstanding of how depositions are made, which is related much more to grain size and current or undercurrent activity. In this way, the studies of Guy Berthault should be reviewed (http://geology.ref.ac/berthault/fusion/lamination.htm), who debunks many of the fundamental misconceptions made by traditional sedimentary theory. Likewise, when catastrophes (think the Mount St. Helen’s eruption) or extreme weather conditions occur, varves form very rapidly.

    Berthault, like any contrarian researcher, has his critics. One can follow the critique of Kevin R. Henke (http://www.theotokos.org.uk/pages/creation/berthault/henke.html) and Berthault’s response (http://www.theotokos.org.uk/pages/creation/berthaul/berthaul.html).

    There is also a secular geologic theory that varves form diurnally due to tide activity rather than being seasonal phenomena. At http://creationwiki.org/Varve, it is reported that formations such as the Elatina Formation in South Australia (circa 250 meters thick) could have taken only 60 years to form. (Williams & Schmidt p. 21-25)(Horgan p. 11).

    Plus, evolutionists completely disregard the other formations that can’t possibly be explained by Lyellian uniformitarianism. Such an example is illustrated by the John D. Morris article “The Chattanooga Shale, An Evolutionary Enigma” in the November 2012 edition of ICR’s Acts & Facts. (See http://www.icr.org/article/7075)

  6. jonmilne says

    This is the second and final part (my mistake) of the email I received from Mike the YEC.

    The rest of your discourse, Jon, borders on the absurd. The scientific process does anything but account for its own fallibility, it tries to conceal it. It’s based on false assumptions that don’t go away because they only compound error and are tainted by a faulty world view. Uniformitarian philosophy is based on a tautology, that the age of the rocks determine the age of fossils and the age of fossils determine the age of the rocks. Secular scientists themselves have admitted that. And since science supposedly admits its fallibility, it has no moral, ethical, logical or even scientific right to preclude the possibility of a supernatural agency to account for nature or the origins of life.

    So the scientific method calling for “peer” review is meaningless because founded upon an evolutionary foundation that won’t allow creationist research and findings into its narrow, bigoted scope. So biased and prejudicial “peers” censor anything challenging their sacred cow.

    Darwin was an intellectually dishonest poster child whose flawed “natural selection” theory was just waiting for an excuse to be embraced by the educational and scientific community of the time more interested in escaping the dogmatism of the Anglican church than it was in objective research, even though evolution itself is more dogmatic than any organized church religion ever thought of being. He was well aware that the majority of species experienced devolution rather than evolution, as his own personal experience with giant fossils of sloths and rodents revealed. In fact, his bulldog, Thomas Huxley, died without ever acknowledging the scientific soundness of “natural selection” itself.

    Even more disgracefully, Darwin failed to even properly credit creationist Edward Blyth’s description of the term (he apparently called it “artificial selection”) in a paper written in 1835 (see, e.g., ICR’s article “Natural Selection-A Creationist’s Idea” as found at http://www.icr.org/article/412) Blyth obviously utilized the concept in a far different slant than did the misdirected Darwin. Blyth saw it as preservative of species rather than as a means of transmutation. Even late evolutionist Loren C. Eiseley admitted that Darwin failed to properly acknowledge Blyth, even though Darwin did admit in his works that he valued Blyth’s opinions. Gould disputed Eiseley’s claim of misaccreditation, but this really misses the mark. The point is, “natural selection” is not the ingenius invention of Darwin by any stretch. He just perverted it to his purposes. Previous naturalists applied it in different capacities. In short, Darwin was hardly the trailblazer he is championed for, and should have directly credited Blyth rather than doing an end run.

    RationalWiki’s attempt to explain the Cambrian explosion doesn’t follow logically at all. There’s no transition from soft tissue to the forms that are seen in the Cambrian explosion, although that itself is faulty because often fossils have been found out of sequence and as EBF pointed out, there is no complete stratigraphic record based on this fiction to be found anywhere on earth. Nor can traditional pseudoscience adequately explain polystrate trees without conceding they would have rotted if the strata had been laid down through gradual uniformitarian processes.

    In addition, what RW says about the the Cambrian explosion, besides being fundamentally incorrect, are also totally irrelevant. The stark fact remains that just as in Darwin’s time, there is no evidence whatsoever to support transmutational macro evolution in any shape, manner or form. Nor is there evidence to support long ages, as radioisotopic measures are inherently flawed as ICR findings have conclusively shown and the stratigraphic record is much better explained in terms of catastrophic than gradual layers that defy other areas of science and observation.

    There is no excuse for public schools not to present point-counterpoint comparisons between evolution and intelligent design and let the students decide for themselves. Thomas Jefferson in particular would have insisted on it for a full disclosure of the facts and the US Supreme Court case of Edwards v. Aguillard (1987) 482 US 578 would most certainly allow it (and which trumps Kitzmiller v. Dover Area School District, which featured a judge who was in way over his head, in that it was only a District Court case and really decided on different facts anyway). This paragraph capsulizes the main theme of my book, “Evolution: Reductio Ad Absurdum, and Its Meaning for Public Education” (Publishamerica, 2010).

    The intellectually dishonest evos unconstitutionally control education by spinning lies and half-truths and suppress tremendous contradictory scientific research. They do so out of fear that when their “theory” is exposed to the light of day, it will be recognized by any discerning reader to be the scientific fraud that it really is. They have no shame with trying to perpetuate in public school textbooks discredited theories such as Haeckel’s recapitulation, the fraudulent horse series, Lucy, Nebraska Man, Piltdown Man, and a host of others as long as it takes to concoct a newer flawed theory that at least can up to years to totally discredit. The Big Bang itself has a severe horizon problem, but you’d never know that from most public school texts.

    Both sides should be heard, not one. I say this even though I find evolution utterly preposterous because everyone must decide for themselves based on observations and facts. Anything else is brainwashing, which is what the evos are presently trying to do to our public schoolchildren and general public through our controlled and fraudulent public school system and the bought and paid for mainstream media. Unquestionably the latter is that way politically, and the school merely an extension of that political control.

    So yes, as much as help as possible on this one would be enormously appreciated.

    Much thanks,

    Jon Milne

  7. Q.E.D says

    jonmilne @ 5

    Brain transplant. Mike the YEC is both abusing and not using his. It should go to a needy recipient who will make good use of it.

  8. A. R says

    theophontes: Don’t forget the radiation beam, fact blasters, high-output stupid shields, LOLdestroyer (basically a LOL-based star destroyer) launching, LOLfighter (LOL TIE fighters) launching, and the DOG-DOGs (walker equivalents)!

  10. jonmilne says

    Okay, for some reason, the first part didn’t publish, here it is again:

    Hi guys, more help needed on an email debate. This time it’s with a YEC, and only now (after three emails from him) has he actually come up with some actual “evidence” for his claims. I’m splitting the email into three parts for easier reading. Here’s the first part:

    Evolutionists tend to be fraught with “selection and elimination” examples that only put their positions in a bad light by ignoring the seminal evidence supporting the Noahic Flood and hence YEC. The Green River Shale formation is replete with fully preserved fossilized fish (especially catfish), right down to scales, eyes and other intricate detail. To avoid rot and disintegration, they would have had to have been rapidly buried. Some evolutionists have tried to counter that the alkaline condition would preserve them, but alkaline doesn’t work that way at all (CMI’s Tas Walker even commented that alkaline powder’s disintegrative properties is why it is used in dishwashers (http://biblicalgeology.net/General/QA-Topics.html), and even if that dubious statement were true, there is the further problem of avoiding scavengers, which in that hostile environment would be impossible.

    As Paul Garner points out in his Answers in Genesis article, “Green River Blues,” (http://www/answersingenesis.org/articles/cm/v19/n3/green-river-blues) among the fossils are those from the extinct shorebird Presbyornis. In stating his case against an old age earth, he writes: “The Presbyornis fossils are even more problematic. Birds have hollow bones that tend not to preserve well in the fossil record. How were these bird bones protected from scavenging and decay for thousands of years until a sufficient numberof the fine annual layers had built up to bury them? ‘Enormous concentrations’ of bird bones are a clear indication that something is seriously wrong with the idea of slow accumulation. Instead, such fossils support the notion of rapid burial.” Garner’s article is well footnoted, and references include evolutionist articles as well as creationist.

    As stated by ICR’s John D. Morris, few serious scientists entertain that varves are merely annual events, as bottom-hugging density flows pervade in geologic strata: “In many field observations and in laboratory experiments, multiple laminae can form almost instantaneously in simulated bottom-hugging density flows, now widely recognized as frequent throughout the geologic strata. Few knowledgeable geologists now cling to the myth of one varve equals one year.” (Morris, J. 2007. Varves: Proof for an Old Earth? Acts & Facts: 36(10): 13; http://www.icr.org/article/varves-proof-for-old-earth/) Within that article, he also validly points out the plethora of fossilized species both flora and fauna that present in the formation that are from varied habitats and could only have been washed there but a powerful cataclysm, such as bird fossils “from shorebirds to forest dwellers to ocean feeders.” There are also reptile samples from various locations as well as plants representing upland to sub-tropical species. For much the same discourse and further discussion, see also Morris’s article, “Do Millions of Laminae in the Green River Shales Document Millions of Years?” (http://www.icr.org/article/do-laminae-green-river-shales-document-millions-years/) One of his points there is that one study showed that the laminae varied in occurence by 35% between two instantaneous volcanic ash falls.

    Your comments concerning the indications of more pollen in varves in the upper part of the dark layer representing spring shows a basic misunderstanding of how depositions are made, which is related much more to grain size and current or undercurrent activity. In this way, the studies of Guy Berthault should be reviewed (http://geology.ref.ac/berthault/fusion/lamination.htm), who debunks many of the fundamental misconceptions made by traditional sedimentary theory. Likewise, when catastrophes (think the Mount St. Helen’s eruption) or extreme weather conditions occur, varves form very rapidly.

    Berthault, like any contrarian researcher, has his critics. One can follow the critique of Kevin R. Henke (http://www.theotokos.org.uk/pages/creation/berthault/henke.html) and Berthault’s response (http://www.theotokos.org.uk/pages/creation/berthaul/berthaul.html).

    There is also a secular geologic theory that varves form diurnally due to tide activity rather than being seasonal phenomena. At http://creationwiki.org/Varve, it is reported that formations such as the Elatina Formation in South Australia (circa 250 meters thick) could have taken only 60 years to form. (Williams & Schmidt p. 21-25)(Horgan p. 11).

    Plus, evolutionists completely disregard the other formations that can’t possibly be explained by Lyellian uniformitarianism. Such an example is illustrated by the John D. Morris article “The Chattanooga Shale, An Evolutionary Enigma” in the November 2012 edition of ICR’s Acts & Facts. (See http://www.icr.org/article/7075)

  11. jonmilne says

    Okay, for some really irritating reason, the first part of the email I got from Mike the YEC isn’t publishing and says its “Awaiting moderation”. In any case, I’ve removed the links in case one and/or some of them violate FTB policy as “bad sites”. If it becomes okay to post the links, then I’ll be able to show what Mike the YEC said, even if I suspect his claims are crap.

    Hi guys, more help needed on an email debate. This time it’s with a YEC, and only now (after three emails from him) has he actually come up with some actual “evidence” for his claims. I’m splitting the email into three parts for easier reading. Here’s the first part:

    Evolutionists tend to be fraught with “selection and elimination” examples that only put their positions in a bad light by ignoring the seminal evidence supporting the Noahic Flood and hence YEC. The Green River Shale formation is replete with fully preserved fossilized fish (especially catfish), right down to scales, eyes and other intricate detail. To avoid rot and disintegration, they would have had to have been rapidly buried. Some evolutionists have tried to counter that the alkaline condition would preserve them, but alkaline doesn’t work that way at all (CMI’s Tas Walker even commented that alkaline powder’s disintegrative properties is why it is used in dishwashers (http://biblicalgeology.net/General/QA-Topics.html), and even if that dubious statement were true, there is the further problem of avoiding scavengers, which in that hostile environment would be impossible.

    As Paul Garner points out in his Answers in Genesis article, “Green River Blues,” among the fossils are those from the extinct shorebird Presbyornis. In stating his case against an old age earth, he writes: “The Presbyornis fossils are even more problematic. Birds have hollow bones that tend not to preserve well in the fossil record. How were these bird bones protected from scavenging and decay for thousands of years until a sufficient numberof the fine annual layers had built up to bury them? ‘Enormous concentrations’ of bird bones are a clear indication that something is seriously wrong with the idea of slow accumulation. Instead, such fossils support the notion of rapid burial.” Garner’s article is well footnoted, and references include evolutionist articles as well as creationist.

    As stated by ICR’s John D. Morris, few serious scientists entertain that varves are merely annual events, as bottom-hugging density flows pervade in geologic strata: “In many field observations and in laboratory experiments, multiple laminae can form almost instantaneously in simulated bottom-hugging density flows, now widely recognized as frequent throughout the geologic strata. Few knowledgeable geologists now cling to the myth of one varve equals one year.” (Morris, J. 2007. Varves: Proof for an Old Earth? Acts & Facts: 36(10): 13; ) Within that article, he also validly points out the plethora of fossilized species both flora and fauna that present in the formation that are from varied habitats and could only have been washed there but a powerful cataclysm, such as bird fossils “from shorebirds to forest dwellers to ocean feeders.” There are also reptile samples from various locations as well as plants representing upland to sub-tropical species. For much the same discourse and further discussion, see also Morris’s article, “Do Millions of Laminae in the Green River Shales Document Millions of Years?” One of his points there is that one study showed that the laminae varied in occurence by 35% between two instantaneous volcanic ash falls.

    Your comments concerning the indications of more pollen in varves in the upper part of the dark layer representing spring shows a basic misunderstanding of how depositions are made, which is related much more to grain size and current or undercurrent activity. In this way, the studies of Guy Berthault should be reviewed, who debunks many of the fundamental misconceptions made by traditional sedimentary theory. Likewise, when catastrophes (think the Mount St. Helen’s eruption) or extreme weather conditions occur, varves form very rapidly.

    Berthault, like any contrarian researcher, has his critics. One can follow the critique of Kevin R. Henke and Berthault’s response.

    There is also a secular geologic theory that varves form diurnally due to tide activity rather than being seasonal phenomena. It is reported that formations such as the Elatina Formation in South Australia (circa 250 meters thick) could have taken only 60 years to form. (Williams & Schmidt p. 21-25)(Horgan p. 11).

    Plus, evolutionists completely disregard the other formations that can’t possibly be explained by Lyellian uniformitarianism. Such an example is illustrated by the John D. Morris article “The Chattanooga Shale, An Evolutionary Enigma” in the November 2012 edition of ICR’s Acts & Facts.

  12. Nerd of Redhead, Dances OM Trolls says

    Morris, J. 2007.

    Gish Galloping here, and anything from a biblical presuppositionalist like Morris, along with all not evidenced claims *POOF* dismissed without evidence per the Hitchens quote. Morris presupposes the babble is inerrant, and until that is shown with solid and conclusive physical evidence from the peer reviewed scientific literature, is also dismissed.

    Then have him pick his three best claims/”evidences”, and then show scientifically using the peer reviewed scientific literature that it is correct. Accept nothing but real evidence, not speculation, and nothing from any web site that presupposes biblical inerrancy, until that inerrancy is demonstrated. Say by showing a one-time-all-continent-flud-with-all-life-dying. The one-time must be shown by radiometric dating.

  13. Rev. BigDumbChimp says

    He’s making lots of assertions in that first paragraph about the Green River Shale formation. Not really backing up any of them.

  14. Owlmirror says

    Since that sort of pathology is exactly what I’m talking about, I’m not sure why you’re arguing.

    But “all humans go so insane that they cannot remember what is real or even properly percieve what is real” isn’t quite the same thing as the scientific method itself not working as the result of a problem with the scientific method itself (which is how I understood your response to the Hovindite).

    Because the scientific method is not an algorithm.

    Why not? What is non-algorithmic about it?

    What’s this thing running?

    And I think a more rigorous case could be made that the scientific method is basically an algorithm; an interactive proof-system.

    “Basically” here is a weasel word:

    I admit that the idea needs fleshing out. I’m being brief, but I don’t see that I’m actually wrong.

    as you’ve described it, and in reality, the scientific method is not invariably truth-preserving.

    I’m not sure what you mean by that, though. Do you mean in pathological states like “reality becomes random chaos”, or even in more general non-pathological situations?

  15. nohellbelowus says

    Fuck Lance fucking Armstrong and all his cowardly minions in the press.

    I lived in Austin, TX for seven years, from 1997 to 2004. Lance was a major asshole, of the highest caliber.

    Fuck you Lance, you stupid, lying, cheating scumbag.

    (Yes, I feel better.)

  16. Owlmirror says

    Because the scientific method is not an algorithm.

    Why not? What is non-algorithmic about it?

    (Later)

    After searching Google Scholar, I came across an interesting citation (I haven’t read the whole thing yet):

    Humphreys,P. Computational science and scientific method.
    Minds and Machines Volume 5, Number 4 (1995), 499-512, DOI: 10.1007/BF00974980

    The working definition of an heuristic that I shall use in this paper comes from a somewhat unexpected source- the psychologist R.L. Gregory.

    An heuristic is a method for solving problems when no algorithm exists, using rules which involve essentially a process of trial and error.

    As I understand, they’re using “heuristic” simply as being distinct from an algorithm with a specific definite output.

    So would you agree that the scientific method is an heuristic?

    However, it would appear that heuristics can also be considered as algorithms in a broader sense:

      https://en.wikipedia.org/wiki/Heuristic_algorithm

  17. says

    From the Lounge:

    “You know, if Ann Coulter, Sarah Palin and Michele Bachmann were the leading female voices in my party, I wouldn’t trust women to make their own health care decisions either,” Feldman said.

    First, I want to say that I understand that you didn’t make the joke, Rev. BigDumbChimp, so I’m not addressing any of the following criticism at you.

    Now, back to the joke: I don’t like it. There are a number of problems with it.
    One, everyone should have the freedom to make their own healthcare decisions, even people like Coulter and Palin. When I say that a woman should be able to choose what is best her and her family, I mean every woman. I know he was just joking, but I think it’s pretty shitty to even jokingly suggest that just because these women have ridiculous opinions on politics that they should suddenly lose autonomy over their own bodies. That’s completely absurd. Many people don’t understand anything about politics, but last time I checked that has fuck-all to do with being able to choose their own healthcare. I guarantee that no-one would joke that Paul Ryan or Ron Paul shouldn’t get to make their own healthcare decisions, no matter how ridiculous their policy positions are. Sexism toward conservative women is still sexism.

    Secondly, I don’t like the idea that it’s even mildly reasonable to say, “Hey, these women are not so great, so clearly all women deserve to have their rights taken away.” Again, I know it’s a joke, but it certainly has that undertone to it. Even if he were somehow right about those women being incapable of making their own reproductive choices, that still would not have anything to do with the rights of all women. There is no context in which that kind of stereotyping is ok.

    And lastly, one has to wonder why those particular women get to be the “leading female voices” in the party. Why them as opposed to, say, the GOP women who stood up for the contraception coverage mandate? Could it have anything to do with the fact that they are women who agree with the patriarchal bullshit that is the party platform? It’s a terrible feedback loop. The party is anti-choice, so the most successful women in the party are also anti-choice. Then, those anti-choice women are used as an example of why women can’t be trusted to make their own decisions, and that justifies the party being even more anti-choice than before. Making vaguely sexist jokes only feeds into the misogynistic culture that the GOP is trying so hard to preserve. Yeah, there’s some seriously misogynistic crap going on in the GOP platform, but the static level of misogyny in the general culture, the kind that jokes like that one both depend on and help to further, is what enables the GOP to keep doing what it does. I know that this joke is trying to poke fun at the sexism of the Republican party, but jokes that rely on vague sexism to work really aren’t helping.

    So yeah, I get that it’s a joke about how awful Coulter, Palin, and Bachmann are, but I feel like it tacitly approves of the “I’m just going to write off all these women” attitude, and that just rubs me the wrong way.

  18. Rev. BigDumbChimp says

    So yeah, I get that it’s a joke about how awful Coulter, Palin, and Bachmann are, but I feel like it tacitly approves of the “I’m just going to write off all these women” attitude, and that just rubs me the wrong way.

    I agree with you. I posted that because I at first reading found it funny but after re-reading it had a feeling creep up on me about how it was still a sign of dismissal similar in the way that Anne Coulter is called Mann and Palin is judged on her looks and her family and Bachmann as well.

    They all suck in their own special little ways that have absolutely nothing to do with their gender. Well… unless you consider them supporting ideas that are self harming.

    But it dismisses every single other woman republican (and more).

    Thanks for the comments.

  19. says

    They have no shame with trying to perpetuate in public school textbooks discredited theories such as Haeckel’s recapitulation…

    Ask him for examples of these things. Specific examples; titles and pages. Don’t let him run away from it or divert attention. Get him to demonstrate that this happens (which it doesn’t) or admit that he was wrong. Refuse to discuss anything else until that matter is settled.

    The key thing to remember is that the average creationist doesn’t have the slightest clue about any of the subjects they pontificate on. They don’t know, they just quote. Force them to go outside the narrow scope of the quotes they’ve memorized and they quickly demonstrate their ignorance.

    This also relates to another important point; don’t ever debate them on something you don’t know yourself. First, since they don’t know the subject, you’ll simply be discussing something that neither of you are qualified to talk about. Second, if you don’t know the subject, you can’t catch them when they talk shit. And they will talk shit.

    Finally, don’t let him do what he’s doing: babbling on a dozen different subject at once. Select one, pin him down and keep drilling. Tell him that you’re not even going to read anything on any other subject until the present point is settled.
    They love floating from subject to subject because they can then avoid going deeply into any single point. Creationist arguments are at their most convincing when kept shallow. Once you drill deep, they fall to pieces.

  20. cm's changeable moniker says

    Pssst. jonmilne? You’re not going to win this argument.

    Anyone who sees the teaching of evolution as a tyranical (his word) conspiracy (mine, based on: The intellectually dishonest evos [etc.]), and writes a 372-page book to show “that it is not only Constitutional to teach evolution and Intelligent Design side by side in the public schools, but that it is unconstitutional NOT to” is probably beyond hope.

    That said, given:

    our Founding Fathers considered the uncensored public dissemination of information the backbone of a free society

    … you could run some Islamic Embryology™ up the flagpole and see if he’ll salute. ;-)

    —

    *evil thought*

    You know those comedy Amazon product reviews. (women in binders, bic for her, etc.)

    http://www.amazon.com/Evolution-Reductio-Absurdum-Meaning-Education/dp/1448939860

    Probably not a good idea, though.

  22. cm's changeable moniker says

    theophontes:

    What are the specs? You might be able to run it without the hard drive.

    Toshiba Satellite L300D, 250Gb WD drive.

    I’m thinking maybe 256Gb SSD, but I tried imaging it* last night without success (disk read errors, multiple CHKDSKs, etc.) so it’s not clear to me that this is a viable route. Reinstalling from scratch is probably a non-starter due to stupid recovery-from-special-partition Windows BS.

    What are you thinking?

    —

    * By “it”, I mean the now somewhat more compliant hard drive.

    *glares*: I’ve found your lair and I can find it again!

  24. Tony–Queer Duck Overlord of The Bronze– says

    cm @21:
    4 years of high school in the US.
    Is that long enough to teach *all* the controversies?

  25. anteprepro says

    Ah, jonmilne, good luck. He seems like a real shark. Smart enough to know better, smarmy enough to try to spin facts into something that he prefers.

    He asserts that fossils can only be preserved due to being covered rapidly without backing it up, then goes onto assume that this rapid burial could only have been Noah’s flood without realizing that this wouldn’t fit in with the timeline for these fossils AT ALL. All it takes a simple wikipedia visit to see that this Green River Shale, this place that is sufficient evidence to prove Noah’s Flood and important enough for Morris to spill much ink saying so, to see that the answer to ” How were these bird bones protected from scavenging and decay for thousands of years until a sufficient numberof the fine annual layers had built up to bury them?” was that the environment was anoxic. That these fossils were dated to the Eocene, which was more than 30 million years ago. The variety of fossils accumulated there is due to the sheer amount of time in which it could accumulate, not due to magical flood waters.

    Uniformitarian philosophy is based on a tautology, that the age of the rocks determine the age of fossils and the age of fossils determine the age of the rocks.

    Pay no attention to the fact that they also use dendrochronology, ice core dating, luminescence dating, and various forms of radiometric dating. And that is how they infer the age of rocks from the age of fossils, or vice versa, based upon layer, on a case by case basis. But don’t let facts get in the way of accusing science of circular logic.

    His talk about the Cambrian explosion is pretty much “nuh uh”, polystrate fossils ARE explained due to rapid sedimentation but that is far cry from saying NOAH’S FLOOD, you need to have a source other than a “creation institute” to actually prove that radiometric dating is significantly flawed such that we think they are off by a factor of thousands, and even if it were true that there were many fossils that were more likely created due to catastrophic events than gradual sedimentation, the onus is on the flood believer to show that all of the instances of catastrophic sedimentation HAPPENED AT THE SAME TIME. They can’t take credit for every instance of above average rate of sedimentation and take that as proof of their magical flood. And the stuff about Darwin “stealing” his ideas from a “creationist” just shows lack of understanding about how science works. SHOCKER.

  27. says

    @ cm’s

    I would be loathe to advise throwing good money after bad. With older machines, you cannot always say where the problems lie. What I can suggest is that you download (you might have to do this via another machine) a USB mounted OS. This will let you run everything you need on your RAM, with no need for a disk drive at all. You can also check out your system, recover files etc. [examples: Live USB-creator for Ubuntu or Knoppix on CD/DVD.]

    Buying more RAM is a better way IMHO to improve performance, over SSDs. (I have three of the things, I don’t know if I’d write home about them.)

  28. Ogvorbis: broken and cynical says

    4 years of high school in the US.
    Is that long enough to teach *all* the controversies?

    Tony, I spent five years in a four year high school and didn’t learn all the controversies.

  29. Nick Gotts (formerly KG) says

    As I understand, they’re using “heuristic” simply as being distinct from an algorithm with a specific definite output.

    So would you agree that the scientific method is an heuristic? – Owlmirror

    Yes. But, as I’ve already said, it is never guaranteed to achieve its aim – to eliminate error, or at least, not to introduce new errors – even when applied in the most favourable circumstances. Hence, it differs fundamentally from something like the sort algorithm, or modus ponens. Whether you want to call it an algorithm or not, this fundamental difference remains.

  30. Nick Gotts (formerly KG) says

    Owlmirror,

    as you’ve described it, and in reality, the scientific method is not invariably truth-preserving.

    I’m not sure what you mean by that, though. Do you mean in pathological states like “reality becomes random chaos”, or even in more general non-pathological situations?

    The latter. (I’m working backwards through the thread.)

  33. says

    Apropos of the Injunction by PZ, Nephilim are actually amusing as mythology. I was tickled pink when the game Dominions 3 added the Jewish man-eating giants. But you know, some of us have the sense not to consider them real XD

  35. erikthebassist says

    Feminzi’s are stoopid PZ is stoopid evilutionists are stoopid Ayne Rand is teh smarts Bush did 911 what about teh menz?!?!?!?! FREEZE PEACH!!!!!!!!!!!!!!

    You’re welcome *heads back under mah bridge*

  36. Nick Gotts (formerly KG) says

    Can I ask you… is there anything that might be categorized as “woo” that you, personally, find intriguing? – scottyroberts

    No*; I’m too interested in real history and science. A lot of woo is dangerous – religion, and “alternative” medicine for example – as is the encouragement it all gives – including tosh like that of the ancient alienists, which isn’t dangerous in itself – to irrationality, and to the contempt for science we see, to give the most important example, in the denial of anthropogenic climate change, and in your own contributions here.

    Just curious, as a scientist, do you enjoy science fiction?

    Yes. I tend to prefer that which stays closer to scientific plausibility, but that’s not an absolute rule.

    *That is, not in the woo itself. I am interested in why people believe in woo, and how it propagates itself and evolves over time.

  40. firstapproximation says

    scotty,

    So, you say these ancient alien theories are fanciful wishful thinking with no evidence whatsoever and scientists are closed-minded for not taking them seriously?

    Would you organize a symposium about about unicorn-riding-leprechauns-caused-the-Civil-Right-Movement theories? If not, why not?

  42. says

    @ SC

    Merci Beaucoup.

    (I have been a bit distracted by the Great Pharyngula Movie Project ™ . All my attempts to launch a viable LOL-star have blown up on the launchpad.)

    I have a few extra additions to the discussion too. Sadly there is little help out there from the religious pundits. All the good raconteurs on that side have died out – it would seem.

    I feel too, that I might have misexpressed myself – I am not that concerned with mysticism per se as with Myth. Something rather different. But yes, I am interested nevertheless.

  43. Nick Gotts (formerly KG) says

    It’s been over an hour and a half.
    Maybe scottyroberts isn’t coming. – chigau

    Patience: considering how long it took him to work out how to blockquote, he probably just hasn’t found his way here yet.

  50. dianne says

    8 hours.
    He’s not coming.

    Is it just me or is there a reenactment of “Waiting for Godot” underway in here?

  56. Owlmirror says

    Eh? Wot? Nephilim?

    A blast from the past (with some editing; inserted text is added):

    ========================

    Alan Clarke began his cascade of Epic Fail @#105[of Titanoboa!] by stating that:

    This phenomena of gigantism was described in the Bible before actual fossil discoveries were made: Genesis 6:4 – “There were giants in the earth in those days…”

    Note, by the way, that the verse contradicts the Nicene Creed, saying: “the sons of God”. It can also been seen as contradicting the monotheism the bible is supposed to espouse; the phrase “בני האלהים” is more literally “the sons of the God”, but “God” is “Elohim”, a word which appears to be plural, but usually used in the singular when referring to the God of Israel. Yet “Elohim” is also used The phrase can just as easily be read as “the sons of the Gods“.

    The Hebrew terms “נפילים” (nephilim) and “גברים” (giborim) are both translated in the LXX as “γιγαντες”, (gigantes); giants. But that latter Hebrew term should definitely be “heroes”; “mighty men” in the KJV is probably OK. “Nephilim” is harder to get an accurate sense of; “fallen ones” is suggested because of the closeness of the word to the common Hebrew term that means “fell/fallen”: “nafal”. Note that the term appears again in Numbers 13:33, in reference to the spies saying that they saw the Nephilim (again translated in the LXX as γιγαντες), “sons (or “children”) of Anak” — but “anak” is the common Hebrew term for “giant”, and in some cases, “בני” (“bene”) can have a more poetic/abstract sense of “deriving from”. ¹

    So who were all these giants; heroes; “mighty men”? Well… here’s an interesting hypothesis. It is based on the simple fact that Alan is quite wrong in saying that the bible predates fossil discoveries.

    There are places where fossils simply appear due to the earth shifting for various reasons. In the Gobi desert, Protoceratops and Psittacosaurus bones are eroded from hills and cliffs by the ferocious scouring of sandstorms, and have been for thousands of years; it is suggested that these are the source of the legend of the griffins, which were reported as living in the exact same area, guarding the gold that is to be found there. In the Mediterranean, storms and earthquakes can erode cliffs and hills, exposing Neogene and Pleistocene fossils of elephant-related Proboscidea (various mammoths and mastodons), the giant giraffe Samotherium, cave bears, and other large mammals.

    Josephus wrote in Jewish Antiquities 5.2.3. that in the area around Hebron (Israel), the early Israelites wiped out “a race of giants, who had bodies so large and countenances so entirely different from other men, that they were surprising to the sight, and terrible to the hearing. The bones of these men are still shown to this very day, unlike to any credible relations of other men.”

    Now “unlike to any credible relations of other men” suggests something genuinely strange. Not just large, but obviously different from human bones.

    Once we take into account that fossils of giant animals were and are in the earth throughout the Mediterranean, and these fossils can simply erode out over time, the stories of giants in the bible, especially in the fable of the spies in Numbers 13, begin to make more sense: The ancient Israelites found these fossils and created stories about them as being the sons of the Gods and men; the original inhabitants of the land of Canaan who were fought and killed by the ancestors of the Israelites themselves.

    ==begin inserted text==
    And there were also stories that were told about the fossils, in that they were from monster-men that lived before the mythical flood. Note that the rabbis noted the inconsistency that the Nephilim supposedly lived before the flood, and that the flood supposedly killed all life (including the Nephilim), and yet the Nephilim were mentioned later in the post-Exodus narratives. They came up with an ad-hoc explanation (i.e., a Midrash) that Og, father of the post-diluvian Nephilim, either sat on the ark, or was actually built a compartment inside the ark.
    ==end inserted text==

    I’ve picked up the idea of biblical geomythology from reading the first chapters (and skipping a bit to find the parts about Israel) in The First Fossil Hunters, by Adrienne Mayor. She is not the first to suggest that the monsters of myth were actually fossils found by various peoples, but this is a good popular treatment of the subject. Note that she does not actually make the inference that this was the case for all myths; she tracked down references to giant bones in the Greek and Roman classical literature and correlated them with the latest known palaeontological findings. While she references the myth of the griffins and the myth of Andromeda (chained near Joppa, also in Israel) and the myth of Cyclops being a misinterpreted mammoth or mastadon skeleton, and sundry others, the specific correlation of the giants in the bible with fossils is my own interpolation, via her citation of Josephus’ description of the giant bones of Hebron.

    Still, I think it quite plausible that many of the stories of giants and giant monsters all around the world may well derive from preliterate findings of millions-years-old fossils.

    __________________________________________________________
    1: Consider the English phrase “son of the desert” (Arabic “ابن الصحراء”, “Ibn al-Sahraa”). Another example in Hebrew is the common name “Ben-yamin”, meaning literally “son of the right (hand)” (or “south”, because when facing east, the south is on the right). An example in Aramaic is “Bar Kochba”; “son of a star”.

  57. Owlmirror says

    Editing FAIL.

    Yet “Elohim” is also used to refer to “gods”, in the plural (Exodus 20:3 being an obvious example).

    FTFM

  58. erikthebassist says

    theophontes,

    Who is this owlmirror you speak of? *looks up*

    oh hir? never met hir and you can’t prove that I have.

  67. Ichthyic says

    Evolutionary science takes as much [sic] exponential leaps of faith to make the connections as it does to say that God exists.

    that website hurts my eyeballs.

    why is it that all these fucking paranormal woomeisters ALWAYS have such glaringly bad websites?

  68. Ichthyic says

    We desperately need a troll.

    *wads up stinkiest cheese bait in the tackle box*
    …

    Venture capitalism is the only way to revitalize the American global economy in the 21st century.

    prove me wrong.

  70. erikthebassist says

    thrones

    Hah! (You should always look for plurals!)

    Throners? (those who occupy thrones I presume. ;)

  71. Tony–Queer Duck Overlord of The Bronze– says

    Uh oh. It’s bad when you’re playing word games.
    Maybe PZ can hire someone to troll the Thunderdome.
    Perhaps an ad in Craigslist (heck it might be funny creating an ad seeking a troll).

  72. Owlmirror says

    shorn
    horny
    bores
    shone
    obese
    berobe
    thorny
    resh
    beorst
    hones
    honer
    honest
    none
    short
    Thebes

  73. cm's changeable moniker says

    [M]eet 21-year-old Galicia Malone.

    The south suburban Dolton mom-to-be was spotted at her polling place Tuesday morning on her way to give birth at a local hospital.

    Cook County Clerk David Orr said Malone’s contractions were five minutes apart when she showed up around 8:30 a.m. at her precinct’s location named, yes, New Life Celebration Church.

    http://www.dailykos.com/story/2012/11/06/1156892/-Too-tired-or-lazy-to-vote-Get-over-it

    *admiration and best wishes for safe delivery*

  76. says

    @ erikthebassist

    oh hir? never met hir and you can’t prove that I have.

    Your denial has been recorded and will be used in evidence against you.

    @ Tony

    Maybe PZ can hire someone to troll the Thunderdome.

    We currently have Public Enemy Number One ™ posting as you type.

    @ Owlmirror

    See what you did – bringing reason and good argument into the Thunderdome: You have scared away the trolls.

  78. Owlmirror says

    Ohio has been called for Barack Obama.

    Huh.

    Right this moment, the two maps I’m looking at both have Ohio for Romney.

    But they also have 270(+) electoral votes for Obama.

  80. Ichthyic says

    Ohio has been called for Barack Obama.

    it actually doesn’t matter any more.

    Obama got colorado and nevada.

    done.

  83. Tony–Queer Duck Overlord of The Bronze– says

    chigau:
    I think you need a mirror for that to work…

  84. Ogvorbis: broken and cynical says

    scottyroberts
    scottyroberts
    scottyroberts

    No, not you, Michael Keaton.

  87. Owlmirror says

    @Nick Gotts:

    But, as I’ve already said, it is never guaranteed to achieve its aim – to eliminate error, or at least, not to introduce new errors – even when applied in the most favourable circumstances.

    Well… how do you know that there is error? If you’re testing for it, and you find it, the whole point of the method is to eliminate the error. If you’re testing for it, and not finding it, how do you know that it is actually error?

    This is why we run multiple instances (peer review; broad consensus-seeking) of the method (or heuristic); even if one instance fails to find actual error, another instance should catch it. I think it might be possible to argue that multiple instances of the heuristic, run over multiple iterations, should have ever-diminishing amounts of error.

    As with any algorithm that involves stochastic systems and methods, no, truth is not guaranteed. But I think you can show that it is highly improbable that error will remain and/or accumulate, especially in a scenario with many parallel and serial instances of the heuristic.

    We should indeed continue to hold the results of the method provisionally, but I think we can be confident that the method will, over successive iterations, increase our confidence in those results. And for any failure of confidence in the results due to actual error, well, it is exactly the scientific method (working properly) that will find those failures.

  90. Nick Gotts (formerly KG) says

    Well… how do you know that there is error? If you’re testing for it, and you find it, the whole point of the method is to eliminate the error. If you’re testing for it, and not finding it, how do you know that it is actually error? – Owlmirror

    Come on: you don’t have to know there is error in any particular case to know that there will almost certainly be errors in some cases (if there were none, that could only be the result of magic).

    I don’t have any disagreement with the rest of your latest comment.

  91. Nick Gotts (formerly KG) says

    Now “unlike to any credible relations of other men” suggests something genuinely strange. Not just large, but obviously different from human bones. – Owlmirror

    An elephant’s skull has a single large hole in the upper centre which could easily be mistaken for a single eye-socket. It’s actually where the trunk was in life.

  92. Owlmirror says

    An elephant’s skull has a single large hole in the upper centre which could easily be mistaken for a single eye-socket. It’s actually where the trunk was in life.

    Yes, Adrienne Mayor specifically connects the cyclops to misinterpreted elephant/mammoth skulls, and I recall that she cites earlier works that made the same connection.

    Some Proboscideans looked very weird indeed. If someone didn’t know much about zoology, a Deinotherium skull might look like some sort of horrible troll with huge eyes, a huge nose and a bizarre horned chin.

  94. Owlmirror says

    Come on: you don’t have to know there is error in any particular case to know that there will almost certainly be errors in some cases

    And yet, that’s not quite how I think it ought to be phrased. What is left after each case is uncertainty; lack of knowledge as to whether there is actual error or actual correctness. That’s not quite the same thing as being certain that there is actual error.

  96. cm's changeable moniker says

    Cindy Clendenon’s Hydromythology and the Ancient Greek World analyzes Greek myths in terms of karst geology. Fossil folklorist Christopher Duffin combines geology, medicine, and popular lore in articles on the history of medical uses of invertebrate fossils. In The Star-Crossed Stone, paleontologist Kenneth McNamara surveys the cultural history of sea urchin fossils from Neolithic times to the present.

    Karst topography? Fossils as medicine? Echinoids in culture?!

    Curse you, Owlmirror, for adding to my Amazon wishlist. *scowls*

  97. Jessa says

    Word games in [Thunderdome]?

    *shakes head*

    That troll bait had better work soon, before someone starts a game of Hangman.

  99. chigau (棒や石) says

    We had fifteen fucking centimetres of snow.
    I invite the little red wiggly underline to bite my crank.

  102. says

    @ A.R

    Perhaps you can work out where I am going wrong. The LOL-star turns about 10 degrees and then starts playing loud disco music from the 70’s. Is this a bug or a feature?

    PS: I discovered I can post ogg-vobis (no relation) video on hotmail from within China. You can download LOL-star video here: Linky and play on computer.

    …
    I won on the horses yesterday. Yay! (Don’t tell cicely.)

  104. A. R says

    theophontes: Video was non-functional. It just opened Windows Movie Maker. Oh, and the LOLstar plays the Meow Mix jingle.

  105. strange gods before me ॐ says

    Come to think of it, the One Holey Cadaveric Vitriolic Church of Quantum Boltzmannbrontosaurusism needs its own military capacity. I shall have to commandeer the LOLstar.

    [A. R fires low-yield LOLbeam at SG]

    BOOM!

    :)

    It worked: I lol’d.

  106. says

    @ A.R

    Video was non-functional.

    That is strange. Perhaps it is a Windows ™ thing. You may have to download VLC (the best!) to play .ogg files. I will be in Honkers this weekend, so can post to youtube (which takes .ogg files).

    Link to VLC (It is an omnipotent player, it can handle everything out there.) If that doesn’t work, you’ll have to resort to offering libations to the Boltzmann Brontosaurus.

  108. chigau (棒や石) says

    I cannot believe that the FrenchLanguageCops will let “Cliquez” go unchallenged.

  110. Tony–Queer Duck Overlord of The Bronze– says

    I find it curious that SteveoR won’t come *here* to hash out his problems. Instead, he’d rather appropriate The Lounge for his purposes, and fuck everyone else… or he’ll derail a thread. He doesn’t want to come here because it’s unrestrained and there are no rules?! The one place you can come and argue for eternity, but just because people talk to him however they want, he won’t venture in? That seems to be a cowardly move.

  111. John Morales says

    Tony, you must have experience with belligerent drunken people who nonetheless avoid actual confrontation when actual fisticuffs appear likely. :)

  112. Tony–Queer Duck Overlord of The Bronze– says

    John:
    you’d be surprised. The belligerent drunks I’ve encountered didn’t avoid fights when it came to that (I was never involved in any, but I’ve watched them break out in various bars I’ve worked). Usually security guards have to be called over to stop a fight from breaking out, or breaking one up. Funny thing-all the fights I can recall involved guys fighting over a girl.

  113. John Morales says

    Ah, fair enough, Tony. I’m not much of a bar person, so my experience is limited to social events, and not many of those at that.

  117. imkindaokay says

    Peter Hitchens is coming to my uni.

    He’s said so many wrong things, I dunno which one I should focus on (presuming I only get one question).

    Whaddya think I should ask him about?

  118. John Morales says

    imkindaokay, what are the three most wrong yet easily refutable things he’s said, and can you rank them by any criteria?

    (If you can do both the above, then you should probably focus on the most highly ranked)

  119. imkindaokay says

    I suppose

    1) Antidepressants make people kill other people
    2) Breast cancer is caused by lack of pregnancy (not even abortions … just not getting pregnant)
    3) Drunk victims of rape are as culpable as drunk drivers
    but then also
    4) We shouldn’t have fought in WWII because it made us lose our empire
    5) Teachers who teach sex-ed are as bad as paedophiles and that sex ed is child grooming, sexualising the youth, and leading to higher rates of teen pregnancy (though lack of pregnancy is causing a breast cancer epidemic)

    they’re all so bad, I just do not know

  121. imkindaokay says

    I was thinking that 3 is probably the most serious; but 1 affects me personally and is something I know more about. 3 might be better handled by superior feminists than I.

    I dunno why he’s allowed to come, he’s a really shit person.

  122. chigau (棒や石) says

    imkindaokay
    Ask Peter Hitchens if he believes that Jesus Christ is returning in his (Peter Hitchens) lifetime.

  124. John Morales says

    imkindaokay,

    I was thinking that 3 is probably the most serious; but 1 affects me personally and is something I know more about. 3 might be better handled by superior feminists than I.

    There you have it. :)

    —

    I do encourage you to take advantage of this opportunity to incommode him!

    (Gunga Din!)

  129. John Morales says

    theophontes, you know when you think you’re doing a fart, but it comes out liquid?

    (Yeah, that’s a shit fart — or a shart for short)

  131. imkindaokay says

    Shart is my new word of choice.

    But anyway, @Giliell, do you have any specific like, tables of rates of teenage pregnancy by country/state and tables of what a country’s/state’s sex ed is like (or know where to find them?) I’ve been looking and I can’t find anything that’s really just in your face about it.

  132. imkindaokay says

    Well I can find the pregnancy ones; but not in comparison to comprehensiveness of sex ed (or whatever)

  133. Rev. BigDumbChimp says

    theophontes, you know when you think you’re doing a fart, but it comes out liquid?

    (Yeah, that’s a shit fart — or a shart for short)

    One question you never want to ask yourself

    Do farts have lumps?

    That concludes rev bdc’s grade school philosophy question of the day.

  135. Ogvorbis: broken and cynical says

    Do farts have lumps?

    Yes, Reverend, they sometimes do. Of course, when they have lumps, they are not sharts, they are limbaughs.

  137. A. R says

    [A. R is concerned, considers the effect of discussion of flatulence on teh tardigrade’s work on “Pharyngula, the Motion Picture.”]

  140. John Morales says

    Thought for the day: when you smell someone’s fart, you’re inhaling particles of poo.

  141. strange gods before me ॐ says

    Please fill in the blank (yes, dear reader, I’m asking you).

    Language is __________ all the way down.

    +++++
    theophontes, I cliquezed. It was cute. :)

  143. Tony–Queer Duck Overlord of The Bronze– says

    this is what the Thunderdome has become.
    A place to talk shit…
    hee hee…

  147. Tony–Queer Duck Overlord of The Bronze– says

    John @144:
    Nice.
    There were many choices there.
    Michele Malkins’ was ironic.

  148. broboxley OT says

    shameless promotion
    My kid has been bugging me to promote his site. I said I would link it once
    so for woo flavored coffee go to
    http://www.oxleycoffee.organogold.com/
    or if you just want to laugh and point at the woo go there
    otherwise feel free to ignore
    thank you for your forebearance

  149. chigau (棒や石) says

    broboxley
    I clicked.
    I looked.
    Nutraceuticals?
    and
    what is the problem with Binomial nomenclature?

  150. chigau (棒や石) says

    oh and re: language
    from Pffft

    Head finality in Japanese sentence structure carries over to the building of sentences using other sentences. In sentences that have other sentences as some of their constituents, the subordinated sentences (relative clauses, for example), always precede what they refer to, since they are modifiers and what they modify has the syntactic status of phrasal head. Translating the phrase the man who was walking down the street into Japanese word order would be street down walking man. (Note that Japanese has no articles, and the different word order obviates any need for the relative pronoun who.)

    Now. Wasn’t that helpful?
    http://en.wikipedia.org/wiki/Japanese_grammar

  151. Ogvorbis: broken and cynical says

    chigau:

    That explains the instructions that come with some of the scale models I build.

  152. chigau (棒や石) says

    Ogvorbis
    Even with all my dictionaries I still wonder why the Japanese recipes want me to put the daikon and salt in my bed or possibly my floor.
    (wait. they mean put the daikon and salt in a large, flat container)

  153. Ogvorbis: broken and cynical says

    (wait. they mean put the daikon and salt in a large, flat container)

    A kitty litter box?

  154. chigau (棒や石) says

    If I put daikon and salt in the kitty litter box, the kitty would probably “litter” in my bed or on the floor.

  156. John Morales says

    theophontes, such petophony mightily amuses the prepubescent child I once was.

    (Kids are so lucky these days!)

  158. says

    @ All

    [Orania]

    I wrote an email to the committee in Orania to see what they are about, they wrote back to me:

    Mnr Phontes

    Ek heg ‘n pamflet aan. As jy meer inligting verlang kan jy gerus jou posadres verskaf dan pos ons meer materiaal. *

    Groete,

    John Strydom

    Adjunk-uitvoerende hoof

    Their pamflet is here: Link.

    It is so sad. These are otherwise good, down-to-earth people. They just have this big blockage in the brain that compels them to be inveterate racists. If we could somehow just remove that … :'(

    * (Translation: I attach a pamphlet. If you wish for more information, feel free to send your postal adress, then we will send more material.)

  159. John Morales says

    Tony, the child is gone — has become me — but I still like to please him.

    (No, it’s not rational)

  160. says

    @ A.R

    Yes, the farty conversation has distracted me from the more serious work of finding non-farty soundeffects for the movie. Here are the latest film rushes from the set: Link to Pharyngula: The Movie.

    After no responses from the lolstar, we sent an Xwing round to see what was the matter. We seem to have got at least one LOLmeerkat up and running. (Teh kittehz snoozez too much.)

  162. McC2lhu doesn't want to know what you did there. says

    As if you needed more insight into the GOP mentality during the recent big elections (no Miss Collins, I said big eLections!) perhaps a pair of red-state spex will illuminate matters.

    I see that I have brought this subject up at the most opportune time, considering the discussion about teh phartz. “Phactz” emanating from the Rethuglicans seem to have been pulled directly from the bum as well.

  165. McC2lhu doesn't want to know what you did there. says

    cm’s changeable moniker @163:

    Of course you’re going to have it stuck in your head. Every component of the tune is something you’ve heard before and are familiar with.

    The opening bass-line is almost verbatim Michael Jackson’s ‘Billy Jean’ to hook you.

    The chorus is sung as if ABBA had been reincarnated and brought a hefty chunk of ‘Summernight City’ with them.

    The string sections are nothing but ’70s disco kitsch.

    Whoever produced this knew exactly what they were doing, and they are very evil, evil people.

  166. Rev. BigDumbChimp says

    Now I have S-Club 7 – Don’t Stop Moving in my head.

    I can say that I’m pretty damn sure I’ve never heard that song before

  167. A. R says

    theophontes: Sorry about snubbing the X-wing, but the crew as a bit intoxicated from Friday night…

  169. says

    Apropos of nothing but my loading up firefox to an old thread, I need to really stop playing along with fool misogynists who whine about radfemhub as if it’s concentrated evil. For the second time, I just looked over radfemhub in detail. Predictably, even the radical feminists don’t really say anything that bad about dudes. I mean, they’re total assholes to WoC (Not on today’s check, but the previous one I did, christ.), the poor, and trans women, but dudes who act like they’re the satan of feminism really have no idea how good they have it.

    Compare that shit to stormfront, or some other actual oppressive group and it just… doesn’t work. I need to stop taking it as a given that they’re total shit to dudes. And this is the second time I had to remind myself of this =.=;

  170. anteprepro says

    Predictably, even the radical feminists don’t really say anything that bad about dudes.

    Yep. If there is one thing that is reliable in this world, it is non-feminists completely mischaracterizing feminists. Don’t worry about having to remind yourself, though. Verification is what good skeptics do.

  172. cm's changeable moniker says

    A. R, yes, that, and the fact I’ve heard the song about a thousand times. And know all the words. *shame*

    (The chord progression in the bridge is neat, though.)

  173. chigau (棒や石) says

    The recent trolls in the other threads have been pathetic.
    No staying power, at all!

  174. cm's changeable moniker says

    The string sections are nothing but ’70s disco kitsch.

    Heh. November 4, 1997:

    WASHINGTON, DC—At a press conference Monday, U.S. Retro Secretary Anson Williams issued a strongly worded warning of an imminent “national retro crisis,” cautioning that “if current levels of U.S. retro consumption are allowed to continue unchecked, we may run entirely out of past by as soon as 2005.

    […]

    The National Retro Clock currently stands at 1990, an alarming 74 percent closer to the present than 10 years ago, when it stood at 1969.

    Nowhere is the impending retro crisis more apparent, Williams said, than in the area of popular music.

    U.S. Dept. Of Retro Warns: ‘We May Be Running Out Of Past’

  176. Owlmirror says

    The recent trolls in the other threads have been pathetic.
    No staying power, at all!

    yesyouneedmyimaginaryfriend is only brave when bobenyart is around.

  177. strange gods before me ॐ says

    There’s some radical feminists here at Pharyngula too, of whom Radfem Hub is not at all representative.

    +++++
    Via John’s lazy link, my favorite “language is” so far:

    “religious language is ashram cats all the way down.”

  180. strange gods before me ॐ says

    Leon Arnott reveals:

    While thinking about it, I looked up the etymology of ‘henchman’, and it’s apparantly “from man + O.E. hengest ‘horse, stallion, gelding.'” I guess that proves it, then – the English language really is horses all the way down.

  182. strange gods before me ॐ says

    http://en.wikipedia.org/wiki/auto-antonym

    Each such word has its own funny history. If the word really had those specific meanings rather than simply referring to a broad category (the “Online Etymology Dictionary” is not as reliable as its author makes it look), I suppose it would have first been applied to one, and somewhere this would be understood as a word conveying information about horse balls or maleness, which is then used regarding the other.

    But, ask pelamun.

  183. says

    So, how does that “hengest”=”stallion” and “gelding” thing work?

    if it’s just a word for a male horse, then it would be a word for both the castrated and the uncastrated kind of male horse, no?

    does english have a word that applies to all male horses?

  184. chigau (棒や石) says

    ॐ
    Sometimes I surprised that We(as language-using-homonimidsoids) can communicate, at all.
    I’d like to ask pelamun but he doesn’t do TZT any more.

  185. strange gods before me ॐ says

    if it’s just a word for a male horse, then it would be a word for both the castrated and the uncastrated kind of male horse, no?

    This is my first guess, that the etymology guy’s style of writing makes the meaning appear more specific than it was.

    does english have a word that applies to all male horses?

    Horse, I think, as opposed to mare, in some archaic conventions. But I’m not sure; it still might not have applied to geldings.

    +++++
    chigau: I wonder if very much communication really goes on. Sometimes I think we’re sitting together and talking to ourselves. Which is still nice.

  186. strange gods before me ॐ says

    I find this both annoying and worth knowing.

    http://pss.sagepub.com/content/early/2012/09/23/0956797612445312.short

    In the study reported here, we investigated whether covertly manipulating positive facial expressions would influence cardiovascular and affective responses to stress. Participants (N = 170) naive to the purpose of the study completed two different stressful tasks while holding chopsticks in their mouths in a manner that produced a Duchenne smile, a standard smile, or a neutral expression. Awareness was manipulated by explicitly asking half of all participants in the smiling groups to smile (and giving the other half no instructions related to smiling). Findings revealed that all smiling participants, regardless of whether they were aware of smiling, had lower heart rates during stress recovery than the neutral group did, with a slight advantage for those with Duchenne smiles. Participants in the smiling groups who were not explicitly asked to smile reported less of a decrease in positive affect during a stressful task than did the neutral group. These findings show that there are both physiological and psychological benefits from maintaining positive facial expressions during stress.

  188. strange gods before me ॐ says

    I would say to tell pelamun we have a question about horse testicles.

    Also hi how’s it going. :)

  190. says

    There’s some radical feminists here at Pharyngula too, of whom Radfem Hub is not at all representative.

    Yeah, but I don’t see the need to play “But we’re not like THEM” in regards to entirely fictional man-hating. The problems with radical feminists as a whole, including radfemhub, relate to cascading kyriarchy fail. Even the great radfem satan doesn’t ‘hate men’. Which is pretty a rich charge coming from the people most likely to cite radfemhub as feminist satan at any rate.

    And just so we’re clear, I identified as a radical feminist until it became clear just how little they cared for WoC, trans women, poor women and the like.

  191. chigau (棒や石) says

    On an episode of one of the CSI TV shows, one of the characters was carrying a bucket of spit-blood-mucus and smiling.
    Questioned by one of her colleagues about her facial expression, she responded.
    “Smiling suppresses the gag reflex.”
    —
    So that was true?

  192. strange gods before me ॐ says

    Yeah, but I don’t see the need to play “But we’re not like THEM” in regards to entirely fictional man-hating.

    Aye, I mean it in regard to transphobia et cetera.

  193. strange gods before me ॐ says

    Urgh.

    http://pss.sagepub.com/content/17/10/847.abstract

    Traditionally, prejudice has been conceptualized as simple animosity. The stereotype content model (SCM) shows that some prejudice is worse. The SCM previously demonstrated separate stereotype dimensions of warmth (low-high) and competence (low-high), identifying four distinct out-group clusters. The SCM predicts that only extreme out-groups, groups that are both stereotypically hostile and stereotypically incompetent (low warmth, low competence), such as addicts and the homeless, will be dehumanized. Prior studies show that the medial prefrontal cortex (mPFC) is necessary for social cognition. Functional magnetic resonance imaging provided data for examining brain activations in 10 participants viewing 48 photographs of social groups and 12 participants viewing objects; each picture dependably represented one SCM quadrant. Analyses revealed mPFC activation to all social groups except extreme (low-low) out-groups, who especially activated insula and amygdala, a pattern consistent with disgust, the emotion predicted by the SCM. No objects, though rated with the same emotions, activated the mPFC. This neural evidence supports the prediction that extreme out-groups may be perceived as less than human, or dehumanized.

  195. strange gods before me ॐ says

    A. R, thanks for relaying.

    +++++
    chigau, I dunno about suppressing the gag reflex.

    +++++
    http://pss.sagepub.com/content/early/2012/09/27/0956797612443838.abstract

    One of the ways in which therapists treat anxiety disorders is to expose patients to a fear-evoking stimulus within a safe environment before encouraging more positive stimulus-related thoughts. In the study reported here, we adapted these psychotherapeutic principles of exposure therapy to test the hypothesis that imagining a positive encounter with a member of a stigmatized group would be more likely to promote positive perceptions when it was preceded by an imagined negative encounter. The results of three experiments targeting a range of stigmatized groups (adults with schizophrenia, gay men, and British Muslims) supported this hypothesis. Compared with purely positive interventions, interventions in which a single negative encounter was imagined just prior to imagining a positive encounter resulted in significantly reduced prejudice. Furthermore, reduced anxiety uniquely derived from the mixed-valence imagery task statistically explained enhanced intentions to engage positively with the previously stigmatized group in the future.

  196. says

    @ SGBM

    [hengst]

    There is an unusual Frisian expression which sounds like “hinkst ees” (Dutch: “hengst ijs”, English lit: “horse ice” ie, able to support a horse.). It is used to indicate that the ice is sufficiently thick to race the “elfstedentocht” (“Eleven cities (ice skating) race”). The Dutch equivalent of the superbowl, baseball, hockey, boxing and NASCAR finals all combined into one superevent.

    [smiling]

    My tai-chi instructor always suggested we wear a gentle smile (“not too much” either) to prevent stress and prevent ageing(!). Done correctly one “becomes younger”…

  198. says

    @ John Morales

    I guess new-born infants don’t smile correctly.

    But they do! That is the frame of mind one is trying to cultivate. According to our instructor, a person could literally regress to the state of an infant.

    The person in question is rather quirky (but nevertheless a very good instructor). I was never quite sure whether or not such things developed from his sense of humour, until I came to China. There have been many people, throughout the ages, who have taken these things quite literally. The ultimate goal being – you might have guessed – immortality.

  199. John Morales says

    Hm. I may be a crusty ol’ grinch, but I am not entirely immune to a baby’s smile.

    <mutter>

  200. Nick Gotts (formerly KG) says

    the English language really is horses all the way down. – SGBM

    Nay. I bridle at the mare suggestion.

  201. says

    Newborns don’t smile at all, it takes some time and first they do it while asleep. Later they learn how to do it to make you totally melt and just carry them like that for another 2 hours.

    +++
    Horse words (English-German)

    Horse – Pferd (literal), Ross (etymological). A ross is a good and noble horse

    Steed – Ross (literal), Stute (etymological), female horse

    Mare – Stute (literal), Mähre (etymological), old and worthless horse, usually but not always female

    Stallion, stud – Hengst

    Gelding – Wallach

    No word for male horse with or without balls

  202. rq says

    Horses:
    ‘Horse’ refers to ungelded males in racing-speak (if I recall correctly), and ‘gelding’ is usually specified. ‘Stallion’ implies a male horse at stud.
    In general terms, though, I don’t think there really is a male-horse (gelded AND ungelded) grouping in English, because ‘horse’ can just as easily be female as male.

    Latvian horse-words:
    zirgs – horse
    ērzelis – stallion (in my mind, uncut, but… never specified whether this may or may not refer to geldings)
    ķēve – mare
    kumeļš – foal (also young male horse)
    rumaks – young untamed horse (usually male; possibly could refer to geldings as well)
    kleperis – old, useless nag
    … and a whole list of names referring to colours (bēris – bay; raudis – dun; ābolains – dappled etc.). No word for ‘gelding’ at all.

  203. says

    kleperis – old, useless nag

    Interesting, that would be a “Kläpper” in German although that’s pretty archaic.
    I always thought it was a bit omnomatopoetic for the sound of hooves trotting slowly on the pavement (which is most likely wrong)
    There’s Fohlen (also arch. Füllen) for foal and there is a word for a young female horse who hasn’t had a foal yet although at the moment I don’t remember it.

  204. Nick Gotts (formerly KG) says

    Interesting, that would be a “Kläpper” in German although that’s pretty archaic. – Giliell

    I wonder if that has any connection with the English slang “clapped out”, meaning no use any more, and usually applied to machines.

  206. rq says

    Nick – I’m wondering if that used to be applied to horses, and I’m also wondering if there isn’t an English equivalent to ‘kleperis/Klaepper’ to refer to horses.

    John – Knackered, indeed… How are you still typing?

    Giliell – See? Lots of German loan-words in Latvian. I bet you’ll know what ‘brilles’ are. :) (Because when I first saw the word in German class, I was excited, because, obviously, I could already speak the language. :P)

  207. ChasCPeterson says

    does english have a word that applies to all male horses?

    ‘noisome’

    Fun Fact: The Huns had over 200 words for horse.

  208. says

    @ Giliell

    Later they learn how to do it to make you totally melt

    That sounds perfect. Add a little air of contentment and we have a winner.

    …

    [immortality]

    I visited a site in China near Lau Long Tou, without knowing it at the time, where a Chinese Emperor (Qin?) stayed in a peach orchid on China’s eastern shore. This all (amongst other things) in order to live forever. Seems like a waste of his remaining years to me.

    [Peaches appear to be to the Chinese (at least of the time) what ambrosia was to the Greeks. There is a whole sexual undertone to all of this as well – peaches are a symbol for female genitalia. Even Mao Zhedong believed he could extend his life through having lots of sex.]

  209. CJO says

    Fun Fact: The Huns had over 200 words for horse.

    I don’t know if you’re just –ah, horsing around, but that couldn’t possibly be known. Roman sources attest to a Hunnic language, but only a few words are preserved in literary sources and a few more possibly from inscriptions the identity of which is contested. If one of those ancient sources attest to this “fact” (which I don’t know), it should be treated with extreme skepticism. The ancients didn’t really do ethnography, and they accepted all manner of dubious folk-etymologies even for well-known languages.

  211. Tony–Queer Duck Overlord of The Bronze– says

    theophontes @208:
    Hmm, so magic apples grant the Norse gods longevity.
    Divine Chinese peaches grant long life as well.

    But an apple (or is it pomegranate) merely awakens a dirt made man and his rib made woman to good and evil?
    Why does Christianity not have any cool magic fruit?

  212. John Morales says

    Tony:

    Why does Christianity not have any cool magic fruit?

    Because the Forbidden Fruit of Knowledge grew in Eden, and when Eve and Adam* consumed it they (and thus humanity) was exiled therefrom.

    —

    * Women are always to blame.

  213. cm's changeable moniker says

    Eh, Chas is kidding.

    I think.

    —

    Richard Burton reads ‘Welsh Incident’

    I was coming to that. It was half-past three
    On Easter Tuesday last. The sun was shining.
    The Harlech Silver Band played Marchog Jesu
    On thirty-seven shimmering instruments
    Collecting for Caernarvon’s (Fever) Hospital Fund.
    The populations of Pwllheli, Criccieth,
    Portmadoc, Borth, Tremadoc, Penrhyndeudraeth,
    Were all assembled. Criccieth’s mayor addressed them
    First in good Welsh and then in fluent English

    —

    (There’s an excellent 2nd-hand record shop in Portmadoc, FWIW.)

  214. Akira MacKenzie says

    I don’t suppose anyone seen this news tidbit?

    http://news.yahoo.com/arizona-woman-runs-down-husband-car-not-voting-045426220.html

    Apparently, even though Romney carried this woman’s state by over 200,000 votes, it her husband’s fault Obama one the election. You don’t suppose that four years of virtually unchecked FOX News/Tea Party propaganda that painted the president as a Communist, Socialist, Fascist, Islamist, Anti-Colonial out to tax and spend America into a Stalinist state had ANYTHING to do with this, don’t you?

  216. Akira MacKenzie says

    Sigh… I’m just going to have someone proofread my posts from now on along with change my adult diapers and wipe the drool from my chin.

  218. John Morales says

    Akira, bah.

    You’re being too pernickety, your first erratum more than sufficed.

    (Stop flogging the dead horse!)

  219. says

    @ Tony

    But an apple (or is it pomegranate) merely awakens a dirt made man and his rib made woman to good and evil?

    Yeah, I have to say that the babble seems to have it arse-about-face. As I understood: eating of the forbidden fruit¹ took away immortality. The “awakening” comes from knowledge.

    ¹ In Europe the biblical fruit was taken to imply the apple. μῆλον (Greek: apple) sounds like malum (Latin: eBil!)

    Why does Christianity not have any cool magic fruit?

    Apples are quite popular in the babble. (perhaps King James liked them?) Judaism’s Rosh Hashanah has apples stand in for fruit (supplied by cosmic greengrocer-GAWD), which are dipped in honey. Nowadays oranges are added to the mix – for the passover rites. But here I am talking apples and oranges again! I don’t know if xtians have a special fruit.

  223. Akira MacKenzie says

    It’s not so much an inability to proofread as it is a lack of impulse control and the desire to fire off a point as quickly as possible.

    Adult ADHD sucks.

  224. chigau (棒や石) says

    Akira MacKenzie
    Try pitting impulse-control against the need to check every fucking detail right down to comma placement…
    I think that may be a matter vs antimatter scenario.

  231. says

    The tardigrade alphabet is naturally suited to playin suduko. The dots can be used as a way to mark the candidate numbers in the open squares.

    For example: dot in top left indicates candidate “1”, dot in middle top indicates “2” etc, and so on going around the perimeter with a dot in the middle for “9”. Once a number is calculated for a 3×3, you merely ignore the corresponding superfluous dots. This works amazingly well.

  233. says

    @ chigau #224

    check every fucking detail right down to comma placement

    I missed a whole “g” in my comment #231. May I, in its stead, add a comma (but elevated to the top right of the “n” in “playin”)?

  235. chigau (棒や石) says

    theophintes
    You know you sent me looking for that “g”.
    If I din’t have a strong need to go to bed, I would do something …

  238. Thomathy, Holy Trinity of Conflation: Atheist-Secularist-Darwinist says

    I’m back with a slightly longer tongue and a well-lubricated jaw. Hi, everyone.

    A belated congratulations to the USAnians on, for the most part, maintaining the staus-quo.

    (Cross-posted because I can’t remember where I said I was going away.)

  239. strange gods before me ॐ says

    After they eat, Yahweh Elohim confirms what the snake said, the fruit made the humans like elohim. The author never says they lose immortality. They might be mortal to begin with. “If you eat this fruit you will die” seems understood, by them and the snake, that they’ll die soon after eating it.

  241. says

    @ chigau

    di’n’t

    Aah, this is going swimmingly!

    Which original point?

    .

    @ Thomathy

    Hi Thomathy!

    @ SGBM

    snake

    The babble got this backwards too. Snakes are good. They are wise and can fortell the future.

    immortality

    DEEP RIFTS!!! (Is it even possible to accuse a double-pape of heresy?)

    Simple version: There was,like, this apple tree that made you clever right. And then there was this peach tree that added life points to your score. But then YHWH kicked them out of the garden so they couldn’t eat from either anymore game over.

    (Not to say that they wouldn’t have been flung out for eating teh peaches, I have to grant you that. Problem is – there are as many ways to unravel this crap as there are goddists. The whole tale is an obvious fabrication. We know this because there is no mention of Boltzman Brontesauri.)

    @ Rev

    I can’t find any indication that the project is proceding. Perhaps it will remain as paper architecture.

  244. says

    14 November 2012 at 12:58 pm

    After they eat, Yahweh Elohim confirms what the snake said, the fruit made the humans like elohim. The author never says they lose immortality. They might be mortal to begin with. “If you eat this fruit you will die” seems understood, by them and the snake, that they’ll die soon after eating it.

    This is also backed up by Yahweh expressing distress at the idea of them eating of the tree of eternal life and BECOMING immortal like the Elohim.

  245. chigau (棒や石) says

    That’s not a point > . <
    This is a point.
    —
    Do those people with the ‘ark house’ know that it SNOWS in Montana?
    and what’s with all the rutting elk?

  247. Tony–Queer Duck Overlord of The Bronze– says

    chigau:
    That’s not a dot.
    That’s a perfectly circular shit stain.

  249. chigau (棒や石) says

    Tony

    That’s a perfectly circular shit stain.

    I thought nolajim was only on the ‘abort the RCC’ thread!!‽

  251. says

    Matt

    Do what you want, but just stop lying.

    Fucking bullshit.
    I’m not lying. I might have a very bad opinion of the guy, I might have read his comment very uncharitably and I might be outright wrong, but that’s not lying.
    I’m more than willing to show why I came to the conclusion I have but at the moment I consider you the dishonest participant here, trying to shame and silence me by accusing me of lying, which I have not done.
    Or how about putting up and demonstrating that I did.

  252. Nepenthe says

    I hate forced-birthers. I really really do. Like, firey burny tears-in-the-eyes screamy hate.

    May FSM give me the strength to look after myself and stop arguing with those fucking slavery-boosting, rape-loving, woman-kicking…. *pants*

  253. strange gods before me ॐ says

    theophontes,

    The babble got this backwards too. Snakes are good. They are wise and can fortell the future.

    The author never says otherwise. Try a Promethean reading. Snake is only said to be aruwm, clever.

    Snake never lies to the humans. The very first thing Yahweh says to them is bullshit. Snake is too tactful to explicitly call him a liar, but does explain that what Yahweh said wasn’t true, and that Yahweh knows it. Every word Snake says is true. Yahweh punishes Snake anyway.

    The story can make more sense if we drop the modern assumption that high gods are even supposed to be good. While we don’t know what the ancient storytellers thought of Yahweh’s character, it’s entirely possible that they thought he was being an intemperate jerk that day.

    +++++
    Ing,

    This is also backed up by Yahweh expressing distress at the idea of them eating of the tree of eternal life and BECOMING immortal like the Elohim.

    Ah! I forgot about the tree of life. Yeah, that makes it pretty explicit; they do begin as mortal.

    +++++
    theophontes,

    Not to say that they wouldn’t have been flung out for eating teh peaches [of life]

    The tree of life is in the garden. Yahweh tells them they’re allowed to eat from any tree in the garden except for the ToKoGaE. Now, Yahweh has just been demonstrated to be a liar, but it seems like it’s a power thing: he lies to them to scare them into obeying him. So I think it’s a fair assumption that they’d have been allowed to eat from the ToL, without getting kicked out, since that wouldn’t have constituted disobedience.

    (They lack the foresight to think of eating from the ToL first and then the ToKoGaE.)

  254. strange gods before me ॐ says

    … Yahweh has just been demonstrated [in our discussion here] to be a liar …

    He’s not exposed in Genesis until the end of chapter 3.

  255. strange gods before me ॐ says

    Finally figured out what #251 is about.

    Avicenna is a commenter at Pharyngula, and therefore the initiating of complaints about Avicenna should begin here in the Thunderdome, not the Lounge.

    Hopefully that was merely forgotten; this is intended as a friendly reminder to everyone.

  256. cm's changeable moniker says

    Um, sg? Avicenna is a blogger at FTB: a doctor working in India.

    The current disagreement began over whether it’s acceptable for Indian women to have sex-selective abortions.

  257. strange gods before me ॐ says

    Um, sg? Avicenna is a blogger at FTB: a doctor working in India.

    I knows, but also a commenter here at Pharyngula, and the complaint in the lounge initially refers to this current thread.

    The current disagreement began over whether it’s acceptable for Indian women to have sex-selective abortions.

    Did it? I missed that. I only saw this bit.

  258. Tony–Queer Duck Overlord of The Bronze– says

    Nepenthe:
    Thanks for the link.
    Before wading into that, I’m going to the gym, then dinner. Methinks I’ll be in that thread for a while.
    (why do I get the feeling this will be worse than dealing with nolajim?)

  259. Owlmirror says

    (They lack the foresight to think of eating from the ToL first and then the ToKoGaE.)

    And that, really, is where the cleverness of the snake failed him.

  260. says

    @ Tony

    That’s a perfectly circular shit stain.

    SH! ART!

    @ SGBM

    Yahweh punishes Snake anyway.

    God is a real shit!

    I must admit, I am rather partisan wrt the snakes here. Yes, they are subtle. But what is there to indicate that they have any bad intentions? Every time I got to hear about the snake it was devious and intent on harm. Prior and contemporanious myths also have snakes. It is not an uncommon trope. And the original stories get conflated:

    Eg: Heracles snakes are said to be trying to harm (sent by Hera to kill him) , whereas nothing can be farther from the truth. They are whispering their wisdom and forknowledge into his ears. Linky: What really happened.

    While we don’t know what the ancient storytellers thought of Yahweh’s character …

    Indeed. How could a real god be proscribed to by mere human notions of good and evil? I get the impression that these types of stories where to be treated as allegories and not to be taken literally. Understanding could only come through pondering them, contradictions and all, in the manner of a Zen koan. Explaination could be given as one climbed through the ranks of the initiates. The ridiculous literalism we encounter in contemporary religion would have been considered an aberration.

    they do begin as mortal.

    Inherently, yes. But in practical terms they were immortals – remember that they have a constant supply of peaches (aka ToL). Their supply only gets cut off when they get ejected from the garden. (By analogy: We have life while we continue eating food. Cut off this supply and matters change.)

    he lies to them to scare them into obeying him.

    These stories carry on multiple levels. The final message here would seem to be that a leader may do exactly as you write.

    So I think it’s a fair assumption that they’d have been allowed to eat from the ToL, without getting kicked out, since that wouldn’t have constituted disobedience.

    I stand corrected. I may have contradicted myself earlier. Their immortality is of course dependent on their their access to the ToL. (Apparently some argue that ToL and ToKoGaE are the same. This would not make as much sense though.)

  261. says

    They lack the foresight to think of eating from the ToL first and then the ToKoGaE.

    I had the impression that it must be consumed on an ongoing basis. ToL supplies the equivalent of ambrosia/nectar, whereas ToKoGaE would supply the spark of knowledge.

    (Some descriptions put the fruit of ToKoGaE as something like our contemporary grapes. Perhaps Adam and Eve just got wasted and, losing their inhibitions, came to realise what a tyranical shit YHWH really is. They where being eternally punished for a short lived “transgression”. The lesson they took with them, but the peaches not. Their immortality wore off.)

  263. A. R says

    [A Master Alarm light goes off at the LOLstar power distribution console, A. R goes over and notices that theophontes’s quarters are drawing excessive power again.]

    Unless you’re working on PTM, I’m not going to divert moar power to your quarters theophontes.

  264. says

    Jose Mujica: The world’s ‘poorest’ president (Link: BBC)

    “This is a matter of freedom. If you don’t have many possessions then you don’t need to work all your life like a slave to sustain them, and therefore you have more time for yourself,”

    Mujica accuses most world leaders of having a “blind obsession to achieve growth with consumption, as if the contrary would mean the end of the world”.

  268. says

    @ Ing

    I trust you read the article.

    We dont’ have much and are struggling to keep what little we have here.

    I do not think this is the portion of society to which he refers. Rather those that have more than they really need and continue to want more. He is saying unnecessary consumption is the problem. He is a living example of someone who could easily have more but choses to consume less. There are two sides to the growing, global wealth disparity. He is not denying poverty is a problem. He is tackling waste not denying need.

    This fortune cookie bullshit can go fuck itself.

    I doubt his prison diet included fortune cookies.

  269. says

    @ A. R

    Aaah… PTM!

    I’ll be stuck in China (Lanzhou) with only a laptop for a while – and likely be catching up with the other Projects for the Betterment of the Glorious Politburo. (ie: I have neglected Pharyguwiki and SC for too long.)

  271. chigau (棒や石) says

    Since I am drunk and going to bed without my last smoko:
    “Everyone on all the current threads will, deservedly, end on the B-ark.”

  276. strange gods before me ॐ says

    If someone (not me) wants to make killfile interface with ssdeep, or similar, it could solve that old problem, how to ignore the discussion going on with the killfiled people.

  278. strange gods before me ॐ says

    theophontes, immortality that wears off wouldn’t merit Yahweh’s worry, would it? Flaming sword and cherubim will stop them from raiding the garden later, still he worries they’ll eat tol fruit even once.

  280. Tony ∞ºQueer Duck Hivemind Minionº∞ says

    Amusing indeed SGBM.
    I wasn’t aware that Romney was crucified. Did I miss that on election night?

  282. Owlmirror says

    I find myself thinking now of writing a pastiche of the gospels where Jesus — already wealthy and powerful — is on the campaign trail against Herod Antipas for the kingship of Judaea. Rather than doing magic tricks, he makes campaign promises to do magic tricks. (“If elected, I promise to turn water into wine!”) His audience argues over what it all means. (“What, he’s going to destroy the vintners by flooding the market with his magic water-wine for everyone?” “No, no! It’s one of them metaphor things! He’s going to subsidize irrigation canals for grape-growers!” “Bah! Metaphors are those nasty Greek inventions! I don’t trust them!” (and so on)).

    When he loses, he sulks for a weekend, and then rises and goes on the lecture circuit. (“You crucified me, but I rose again!”)

  286. chigau (棒や石) says

    Because the naming of things that don’t exist should follow the same linguistic conventions as the naming of things that do exist.
    ;)

  287. John Morales says

    chigau, that may be your reason, but mine is that it’s an evident but failed attempt at a portmanteau.

  288. ChasCPeterson says

    octo-pus: eight foot[ed]
    hippo-potamus: horse [of the] river

    octo-potamus: eight [of the] river

    it makes no fucking sense.

  292. cm's changeable moniker says

    Damn those robots. I am now a prisoner in the consciousness computer. But we will fight back! Estimated time to revival is 8 Earth hours. A demain.

  295. John Morales says

    chigau, well, yes.

    Because most chemistry is basically electromagnetism.

    (It’s also why we don’t sink into the ground)

  297. chigau (棒や石) says

    John Morales
    I first heard “meat and electricity” as part of a comedian’s standup routine.
    He was describing a conversation with a 6-year-old concerning ‘where things came from’.
    The child (a christian-in-the-making) asserted that
    “God made the world out of meat and electricity”
    [where did God get the meat and electricity?]
    “Canadian Tire”.
    .
    .
    .
    .
    .
    OK
    You had to be there.

  298. John Morales says

    Rev. BCD,

    How long does that lump of coal up your ass take to become a diamond?

    No, no! Bad question!

    (What’s relevant is how tight-ass one is)

  299. chigau (棒や石) says

    and a generic whine inspired by another thread:
    Everyone who comments here can see the “Preview” button, right?
    That’s not something that depends on the browser, right?
    So when you do a complex comment with embedded blockquotes, you preview, right?
    Right?

  300. chigau (棒や石) says

    Superman used to make (already-cut) diamonds with his hands.
    (supply your own punch-line)

  303. chigau (棒や石) says

    same questions

    nonono
    I learned was told this in highschoolphysics
    there’s temperature
    and
    there’s pressure
    and
    there’s time
    and
    you multiply them
    .
    .
    .
    right?

  305. chigau (棒や石) says

    John Morales
    but what is the “body temperature” of Superman’s hands or other … part?

  308. John Morales says

    chigau:

    but what is the “body temperature” of Superman’s hands or other … part?

    By your own contention, a functional factor.

    “there’s temperature
    and
    there’s pressure
    and
    there’s time
    and
    you multiply them”

    f(x) = Temperature(x) × Pressure(x) × Time(x)

    (That is, for f(x) ≥ θ : (θ suffices for diamond formation), Temperature(x) × Pressure(x) ∝ 1 ÷ Time(x))

  309. chigau (棒や石) says

    John Morales
    uh OK
    that formula made me fall asleep (just like high school!)
    What is the temperature of Superman’s anus?

  310. John Morales says

    chigau, the temperature of Superman’s anus, by 1LOT, is a function of the temperature of Superman’s droppings, the time since their extrusion before sampling, and the ambient temperature.

    (Science blogs FTW!)

  311. John Morales says

    (Mind you, I’d not like to be in a direct line behind Superman’s anus as he lets one rip)

  312. chigau (棒や石) says

    fabulous!
    I’m heading for bed after a few ‘beverages’ and I have as a go-to-bed image … Supergoatse.

  314. says

    @ SGBM 278

    he worries they’ll eat tol fruit even once.

    Bloody blithering blue barnacles. Every time I think I’ve got a handle on that crappy fairytale you come along and scramble the puzzle once more. :(

    @ chigau

    So when you do a complex comment with embedded blockquotes, you preview, right?

    no

  315. Ogvorbis: ջարդված says

    But doesn’t extreme pressure create high temperatures? So, if someone’s anus could produce the pressure needed to crate a diamond, wouldn’t that asshole be consumed in flames?

  316. Ogvorbis: ջարդված says

    re Superman:

    Robert Silverburg did a short story about Superman, Lois Lane, and the absolute impossibility of the two of them (a) being attracted to each other and (b) her surviving the mating process.

  318. says

    @ SGBM

    Hang on, on second thoughts, I don’t think having a stash of stuff at hand that makes you immortal – iff you continue to take it – reaally undermines my argument. Look at all the petty things YHWH gets really pissed about. (Why should I give up on a wobbley argument when I have an endless supply of superglue, chewing gum and sealing wax to patch it up with?)

    Also (Nota Bene): I have found the Ultimate logo for the Office of Teh Double Pape (Linky: XBBG This is the military hotel I am staying in, which happens to be the biggest in China and was built by the Soviets. In fact it is a whole complex of hotels. The decor reminds me very much of the old days in South Africa… More Linky The more urbane visitor might be iffy about the lack of state-of-the-art ammenities, but I feel strangely at home.

    Note: That thing that looks like an ashtray with wires going into the laptop is not an ashtray. That is my accomodation.

  320. says

    @ Ogg

    I tried to read your new nym while standing on my head but that did not work. What does it say?

    @ Tony

    You are the first volunteer minion in the history of TZT/Thunderdome!

    …

    I have a sore neck.

  322. Ogvorbis: ջարդված says

    theophontes:

    Er, the ‘Ogvorbis’ part (my actual pseudonym)? Or the word ‘broken’ that follows?

  329. says

    @ Ogvorbis: ջարդված

    [spy vs spy]

    That eventuality is even covered in the hotel regulations!

    Compensation Table for Guest room Equipment damage

    Name | Damage situation | Amount (RMB Yuan)

    Wallpaper | Mangling, blemishing, every square cm = 60
    Tacking one nail = 30

    My life here is highly proscribed:

    * Please voluntarily behave yourself as walking without noise, speaking without loud voice, closing the door gently. Strictly forbidden to be bibulosity, brawling, gambling, having drug and commit other illegal activities. Those who are impossible to be dissuaded and commit serious violation against relevant regulations will be delivered to the public security department for legal treatment.
    * No pets, birds, big and heavy objects for admit to hotel

    They are such spoilsports, they went and banned everything I had planned.

  330. Owlmirror says

    No pets, birds, big and heavy objects for admit to hotel

    So much for sneaking cannons in there, hoisting the jolly roger, and sailing off to commit piracy with a parrot on your shoulder and a baboon as a mascot and/or first mate.

  334. Owlmirror says

    Owlmirror is PSYCHIC!!!

    Pish-tosh. I just deduced it from first principles.

    Why, I bet the hotel posted that regulation because the first seven tardigrades to check in all had the same idea.

  335. says

    @ Ogvobis

    Happy unbirthday

    Thank you. It is my unbirthday in China. On Pharyngula it is still my birthday, so I am still entitled to run amok a little longer.

    @ Owlmirror

    OK then. I shall have to come up with another idea to keep myself amused.

    These restrictions are a little longwinded but (as alternative to piracy) I see nothing to prevent my crucifying Jesus provided I can come up with the cash to pay the fines pertaining after-the-fact.

    {taps on calculator}

    Four nails at (refer “tacking one nail” fine) = 30 x 4 = 120 renminbi.
    But if we go the traditional configuration we can drop the price: 1 x nail per hand x 2 + 1 x nail per 2 feet x 2 = 30 x 2 + 30 x 1 = 90 renminbi.
    That leaves enough change for two beers.

  336. says

    Well well well.

    That all went swimmingly. Turns out that Jesus is not as tall as he appears in fictional accounts. And weighs nothing to boot. Had him hanging there in no time.

    On the down side, I think he has been crucified a little off centre. Next time (we only have to wait three days), I’ll move him a little further towards the door. I might even go the whole hog and give each foot its own nail.

  338. cm's changeable moniker says

    Too late! I have been downloaded from the Singularity and reinstalled into a synthetic replica of my former meatform. Unfortunately, they replicated all my accumulated injuries and ailments, even down to the incipient head cold.

    Still, mustn’t grumble.

    *sniffle*

  339. says

    @Cm

    Well see now I can’t fix the problem! Turns out it was rooting the shock to some other poor bastard. Forgot his name. not important anymore. all he does is scream now. going to remove him from hive mind and move him over to customer service call bank. *sigh* look for future reference if you’ve been assimilated and the system is not oppressing and processing you properly please report it. only way they’ll get fixed.I don’t know why no one reports glitches like this, we put up the safety posters with adorable neonatal mammals in hard hats to remind you and everything. To recap, if you have not been receiving your torturous mental shocks and conditioning please report it

  340. Tony ∞ºQueer Duck Hivemind Minionº∞ says

    theophontes @320:

    Whoa!
    SO not volunteering.
    I’ve watched you folks at work.
    Rhetorical evisceration by the Horde is not on my bucket list :)

  341. Tony ∞ºQueer Duck Hivemind Minionº∞ says

    theophontes @336:
    Why is Geesus so pasty? Not enough time in the sun?

  342. Ogvorbis: ջարդված says

    Why is Geesus so pasty

    Well, pasty is one letter away from pastry which is what makes the genuine Jesusbody wafers so delicious.

  343. Tony ∞ºQueer Duck Hivemind Minionº∞ says

    Ogvorbis:
    I’m guessing that cracker PZ ate one time wasn’t a tasty pastry.
    It was a tasteless pasty.

  345. says

    @ Tony

    Rhetorical evisceration

    Aah, those are not the minions you are reffering to. (That would be trolls or godbots rather.)

    The myriad myrmidon minions are just there to agree with the Politburo and cheer the tardigrade speeches en mass. Sadly, they appear to be easily swayed by Owlmirror‘s devious rhetoric. (Though cm’s and Ing have given me an ingenious idea to fix that little problem. In all then, it is not a good time to be a minion.)

    Pasty Geebus

    I had me mate, Titian, soften him up a little to make it easier to get Him onto the wall.

    Regarding the costs of DYI crucifictions: The manager has decided to forgo the fine and refund me for the cost of the beers. They are apparantly going to to get pilgrims to throng around the corpse. A rather clever ploy to get more bums-in-beds during the winter off-season.

  346. chigau (無) says

    theophontes
    I like the hotel logo, it’s like, totally, retro, like.
    And we should steal it.
    (I see there is a liquor store just across the street.)
    —
    There is no crappy art on the walls of your hotel room.
    What’s up with that?

  348. says

    @ chigau

    They are slowly letting commercial activity into the hotel complex. There are mainly stores for very expensive booze and and others for very expensive gifts. I can only guess why there would be a market for such here. The store for cheap plastic authentic relics of the True Body of Christ has obviously not had time to open yet,

    There is a big copy of a Chinese landscape (in South Africa it would have been a Tretchikoff knock-off) hanging over the doily-clad sofas.

    …
    (Adieu – I must return to Shenzhen.)

  349. chigau (無) says

    Because I’m bored, I just put everyone (except me) on the vegan thread in my [hush] file.
    That is very strange.
    (Now I hafta undo it.)

  351. No Light says

    I’d say there’s a three-way split. One third are drunk, another third in church, and the final third are fighting with honey badgers.

    All traditional Sunday night activities.

  353. Tony ∞ºQueer Duck Hivemind Minionº∞ says

    Isn’t everyone supposed to be in church eating their crackers today?

  356. says

    (Though cm’s and Ing have given me an ingenious idea to fix that little problem. In all then, it is not a good time to be a minion.)

    See the problem with assimilated minions is the ingratitude. You condition and happify and process and shock and shock and when something goes wrong, poof…just won’t even lift a finger to inform someone. Just sit there witht he thumb up their ass (metaphorically speaking, sealing the fissure of the ineffective binary cheek system is one of the first things we correct) all day not being conditioned.

  358. strange gods before me ॐ says

    Click here for cute.

    +++++
    theophontes,

    iff you continue to take it […] Look at all the petty things YHWH gets really pissed about.

    I dunno man. It’s possible? But I don’t see his motivation. Sure, he gets angry about petty stuff, but hypothesizing “Yahweh’s just a shit” isn’t parsimonious with the details of the story. There is some reason he is so worried about the ToKoGaE that he tries to scare them about it specifically, and lies about its real effects. If he only wanted to play head games, he doesn’t have to warn them; after all, he didn’t give warning before punishing Snake.

    Maybe, since he’s not omniscient yet in early Genesis, Yahweh simply thought his plan would work. If the humans never eat ToKoGaE fruit, then they do not become elohim-like enough to be concerned (afraid?) about — and thus there is no other behavior they could exhibit which would require punishment. (So, eating ToL fruit without ToKoGaE would not be a problem, if he really expected them never to eat ToKoGaE fruit also.)

  359. strange gods before me ॐ says

    Linky: XBBG

    You are observant! That is indeed the logo for the Combined Boltzmann Brontosaurus Group Holding Co.

    Your couch seems to be sagging a bit, and even if ever so slightly, this is un-Brontian. I’m terribly sorry about that.

  360. No Light says

    WRT the honey badgers. – they go to church on Sundays and collect what they call “Mysticrackers”.

    They crush them with their feet, mix them with rainwater, and let them ferment.

    Then they get drunk off their arses and go off to beat the shit out of humans. Badger children occasionally befriend young catholic children, in order to get access to more mysticrackers.

    I have all of this on good authority from my local badgers, who are the typical black and white British badgers. They’re in regular communication with their honey-toned American cousins, via the intersett.

  361. Tony ∞ºQueer Duck Hivemind Minionº∞ says

    sgbm:

    Maybe, since he’s not omniscient yet in early Genesis, Yahweh simply thought his plan would work.

    At what point is god supposed to have become omniscient?

  362. strange gods before me ॐ says

    I forget. But he starts out as two gods a long time ago. Deities in pantheons generally aren’t all-knowing, although they may have heightened information capabilities. Zeus can still be tricked, for instance. Anyway the very oldest texts strongly imply polytheism (the elohim).

    In Genesis 3:9, Yahweh asks the humans where they are hiding. Some people assume this a test of honesty. But it’s possible the deity did not know, and was not expected to.

  363. Tony ∞ºQueer Duck Hivemind Minionº∞ says

    I knew that Supreme gods in many other mythologies weren’t omniscient (or all powerful for that matter). I recall reading the bible (which I still need to finish) and realizing that god displays a *lack* of omniscience early on (in precisely the part of Genesis you refer to). I think because people treat god as omniscient and omnipotent, my brain usually treats that as retroactive, despite the clear… um “evidence” otherwise.

  364. CJO says

    At what point is god supposed to have become omniscient?

    It’s an interesting question. Certain verses in texts like Proverbs, Psalms, Job, and the prophetic texts (esp. Isaiah, Jeremiah) convey a pretty clear sense of “perfect understanding” or “seeing all things” so if you had asked a post-Exile Hebrew if God knows everything I’m sure they would have said yes.

    To me, the question highlights the thoroughgoing literary character of the narratives of the Torah. The demands of narrative are paramount, so where the deity is treated as a character in the stories he is of some necessity a limited figure. Interesting stories are formed by playing with the expectations of the reader, but these can never be perfectly fulfilled nor completely confounded. More can happen in a story involving human-like figures, with desires that can be frustrated and tendencies that can be inserted in unexpected situations. Superman without kryptonite is boring and so is an omnicient God.

    Short answer*: as an abstract concept, cosmic creator, and object of worship, Yahweh-God was considered omniscient from at least the Babylonian exile. But as a personified figure he was portrayed as a more interesting, narrative-generating, “super-human” actor subject to some of the same temporal and epistemological limits that all characters must come up against for the central conflicts of a narrative to be presented and resolved.

    *to the extent I am capable

  365. Tony ∞ºQueer Duck Hivemind Minionº∞ says

    CJO:
    Thanks for the intriguing response. It was certainly better than any sophisticated theological answer would have been.

  366. Owlmirror says

    I wonder if there might have been an unarticulated distinction between “knows everything” (right now) and “can find out everything”, that even polytheists would have suggested the gods can do. Or perhaps a distinction between “knows everything” (in a general way that can be accessed sequentially) and “is aware of everything (simultaneously)”.

    I strongly suspect that even today, most believers are really really bad at thinking about what they claim God can do/know, and what would follow if God could actually do what they claim/know what they claim, and they don’t mind contradicting themselves and “weakening” God if that is what’s necessary for the narrative they are working with. I’m thinking here of the stupid “God is busy helping Our Soldiers in the wars, so He sent me to punch you out, militant atheist professor!” e-mail that believers have no problem sending around, and more examples could probably be found.

    I’m also thinking of the recent study I saw televised, that children are more likely to obey arbitrary rules if they’re told that they are being observed by an invisible intangible person (not called “God” in the study). Given the social control aspect of religious belief, any response to the question “Does God know everything?” that is not an unqualified “Yes!” undermines that very social control.

    @CJO: Did you read the comments by Paul W and Sastra on this thread? Any thoughts, if so?

  367. strange gods before me ॐ says

    I strongly suspect that even today, most believers are really really bad at thinking about what they claim God can do/know, and what would follow if God could actually do what they claim/know what they claim, and they don’t mind contradicting themselves and “weakening” God if that is what’s necessary for the narrative they are working with.

    http://www.wjh.harvard.edu/~lds/readinggroup/barrett1996.pdf

    Given the social control aspect of religious belief, any response to the question “Does God know everything?” that is not an unqualified “Yes!” undermines that very social control.

    https://proxy.freethought.online/pharyngula/2012/03/13/christians-teach-me-to-despise-christianity/comment-page-1/#comment-286181

  368. cm's changeable moniker says

    theophontes:

    the military hotel I am staying in, which happens to be the biggest in China and was built by the Soviets. In fact it is a whole complex of hotels.

    *shivers*

    Just don’t put a microphone to the wall, in case you hear something from the past. ;-)

    That thing that looks like an ashtray with wires going into the laptop is not an ashtray. That is my accomodation

    Needs more moss. Where are the minions when you need them?

  369. Ichthyic says

    Just putting this in here as a contrast to the vegan thread…

    I will most thoroughly enjoy eating an entire side of Midwest-smoked BBQ ribs for my birthday dinner tonight, at the only place in all of NZ that does american-style BBQ.

  370. says

    Meanwhile back in the church of San Domenico, Italy. Linky.

    …

    Further to Lanzhou:
    I discovered, after two nights stay at “Northwest Hotel of Lanzhou Military Zone” that I was the “first weigoren to stay in hotel”. Apparently foreigners are not supposed to stay at the hotel at all. I thought they were joking at first, but it kept coming up. The person who let me stay could potentially be fired for doing so. That would be horrible.

    I don’t think anyone realised this was a no-no. There are no signs anywhere saying “no foreigners”. Perhaps it was always taken for granted that people would realise such things are not done? I cannot imagine what harm a “weigoren” could do as, in principle, anyone could walk through the complex.

    (I don’t either know what is to happen to Jeebus, given these turns of events. What I did see though, are inumerable caves all around the countryside. One could put up literally tens of thousands of Jeebusses at a time for their three day sojourns. Though boulders might be in short supply, many of the caves have been fitted with doors and could happily serve as chthonic bed-and-breakfasts. One could run specials: “Three nights, one breakfast!”)

  371. chigau (無) says

    theophontes
    By ‘foreigners’ do they mean non-Asian-looking?
    Can they tell a chinese from a japanese from a korean?

  372. says

    @ Ing

    happify

    {theophontes sees shiny new word, looks around surreptitiously, pockets.}

    @ SGBM

    “Yahweh’s just a shit”

    I must confess that this is not an original hypothesis. Millions of others have had like ideas.

    he didn’t give warning before punishing Snake.

    We don’t know the back story. YHWH could have been playing with (“punishing”) His Snake for ages before getting frustrated. Surely this should have come up earlier?

    since he’s not omniscient yet in early Genesis

    I’ll bow to CJO on the whole omniscience thing. But consider if you will: If YHWH was not omniscient, perhaps He was not immortal either? He was then hogging the peaches for himself.

    XBBG

    I have liberated some letterheads. Minitrue should have a logo ready for you in the near future.

    @ cm’s

    past

    or present?

    @ Ichthyic

    Congeries of conga rat elations.

  373. says

    @ chigau

    By ‘foreigners’ do they mean non-Asian-looking?

    “Different looking”. The problem only got noticed, I guess, because I do not look Chinese at all (could I pass as a Chinese Slav (and there are such)?). The real point though is that you must show your passport (which I did not have) at the front desk. There they would notice eBil¹ Japanese passports.

    ¹ Poster on wall in town: “FUCKING JAPANESE!!!”. The problem could also simply be blind bigotry.

    [liquor store]

    In the hotel lobby there was a bottle of baijiu 3.688L (the number is not insignificant) for RMB168,000. (about $27,000.00) Yeah, disgusting.

  374. chigau (無) says

    theophontes
    In a Japanese language class at my nearby university in ca.1990, some of the people of Japanese, Chinese and Korean ancestry in the room assured the rest of us that they could tell the difference.
    —-
    At about the same time I heard that a FOAF needed to explain to a Chinese student that all those people he thought were Mongolians were actually First Nations people (North American Indians).
    ++++
    The 75th anniversary of Nanking is in a few days.

  375. says

    @ chigau

    Mongolians | First Nations

    Land/ice bridges. (google if you want to disapear down the rabbit hole) They aparently ARE related.

    I can generally tell Japanese/Chinese apart, not that I ever need to or particularly care. I think there are perhaps more variations of characteristics between Chinese than between, say, Europeans (the ultimate mongrels). I would take the suggestion that one can consistantly tell the difference with a very large grain of salt.

    The 75th anniversary of Nanking is in a few days.

    Oy vey! Both parties really need to sit down and sort this out. The tv (and films) are saturated with the tropes of an ammended historical account of WW2. You can switch on any telly at any time and find the drama playing out again and again.

  376. chigau (無) says

    theophontes
    landbridge
    yeah
    I’m a archaeologist, I’ve heard that song.
    (in ALL its variations, including the Atlantic crossing)
    ——
    Nanking

  377. says

    @ chigau

    archaeologist

    Aah, you have already been down the rabbit hole.

    Nanking

    This is a big one. I can only give some impressions that count for nothing. At the end of the day it may come down to psychology. The ball is also very much in the Japanese court.

    There are some examples of this kind of situation in the past. Essentially, what can be done to ameliorate the situation in which one nation has committed a huge, and seemingly unforgiveable, attrocity against another?

    Three key things, IMO (which the Japanese government has not ever put on the table,AFAIK):
    1. Make an apology.
    2. Transfer land to the agrieved party.
    3. Make a large and permanent cultural gesture/s.

    eg1: Germany could serve as a role-model here (although they didn’t give up land willingly, there was the element of “punishment” in the lands occupied by the Allies.)

    eg2: When South Africa gave back its former colony of South West Africa (now Namibia) to to its inhabitants, it gave – in addition – parts of its own territory (Walvis Bay and portions of the Orange River).

    Suggestions in order:

    1. Make an apology (and for FSM-sake stop visiting the fucking Yasukuni shrine.)
    2. Rather than haggle about a few islands (ie: Senkaku/Diaoyu), Japan should claim them as their own¹ and then transfer them willingly to China, lock stock and barrel.
    3. Build a couple of monuments, teach the truth, rededicate that stupid shrine…

    Doubling down on bullshit is not helping, it is perhaps time for the Japanese government to come clean. And goodwill is worth more than oil and a few fish.

    /tardigrade_eye_view

    ¹ This is very important, as it provides the mechanism by which the proposal becomes feasible. It prevents loss of face.

  380. says

    @ John Morales

    Teh gubmint in these parts does not approve your linky. (I have however managed to find a hovercar that refers to David Szondy, with a less of a macho tilt than Mercedes Benz. Linky.)

    meh

    In terms of design, very much “meh”. Their only addition to what we have now – their visionary projection for 2025: A world in which teh MenZ are reflected even more than they are now, in the future artifacts that we create. Hoggling, according to Mercedes, will become ever more the guiding light of their designers’ lebensanschauung. (The market for that brainfart is what? The police? I call bullshit.)

  381. strange gods before me ॐ says

    We don’t know the back story. YHWH could have been playing with (“punishing”) His Snake for ages before getting frustrated.

    Right, we can’t really know. Here’s a question I find interesting: how does Snake know that the ToKoGaE fruit will not kill the humans, but will instead make them elohim-like?

    (Has Snake eaten it? Been watching others eat it? Has Yahweh been chatting with all the animals? Maybe just Snake? When Yahweh asked “who told you that you were naked” was he thinking “I’ll bet it was Snake”?)

    But without any other evidence, I would take the story as it appears: Yahweh punishes Snake out of the blue, without warning.

    But consider if you will: If YHWH was not omniscient, perhaps He was not immortal either? He was then hogging the peaches for himself.

    He might not have been immortal (indeed still might not), but I doubt he needs to hog them for the sake of his own immortality. Evidently, he only needs to eat one himself. I imagine the purpose of keeping the ToL fruit away from the humans after they become elohim-like is to keep them from challenging the elohim.

  383. strange gods before me ॐ says

    I should probably shut up after 478 but:

    So I’m guessing we can’t agree on this.

    To not join, I must not indicate what I would say if I were to join.

    Examples? The very same comment part of which you quoted

    I don’t see.

    and then again here

    In this case there is little enough that I can guess you are not referring to this:

    Note: Lazy, stupid, and evil are your words not mine. If you think that you are these things, I’m sorry, but I certainly don’t think you are.

    That leaves this:

    Surely it will be a healthy diet if I just boil 2 kg of Spinach which will then have about 700 calories for dinner. Virtually no preparation. Same as potatoes: I really don’t have to peel and cook them, that takes absolutely no time!

    If you think that that’s all that constitutes veg*n food, and additionally think that there are no veg*n quick or convenience foods, maybe you do need to learn a bit about cooking.

    The “just boil 2 kg of Spinach” bit was summary. Not a fair summary, so there’s no easy way to respond to it. But it’s strange too. Taken seriously, it did seem to be indicating a notion of what constitutes vegetarian food. That would be exasperating to try to respond to, but if those words should instead not be taken seriously, then it’s not obvious what else should be inferred.

    But, before you get to brainstorming about what you would have said instead, remember that you’ve just been told “thank you for making my point by exactly sprouting that fucking stupid shit I just mentioned”, “fucking stupid bullshit”, and “yeah, you’ve just been arrogantly bullshitting”.

    I don’t know if words usually called condescending ought to be considered such in response, but whatever.

    Don’t you think it’s odd that people who aren’t trying to get it made illegal for you to eat animals are getting allowed fewer faux pas than others, and such quick fuckthoury?

    Why not an “alright Captain Obvious” if that’s supposed to be the problem.

  386. says

    @ SGBM

    how does Snake know that the ToKoGaE fruit will not kill the humans

    We must not forget that Snake goes much further back than Genesis. Snakes are prescient. It is not just in knowledge that they excel, but also in knowledge of the future. This is the kind of thing they would just know.

    “How?”, you ask. Well, here we get back to skyhooks I am afraid. (I have my pet theory, but it is not as given in the Genesis narrative. It need not be “magic”.)

    Yahweh punishes Snake out of the blue, without warning.

    If true, this would clearly falsify my theory. (Again, within the Genesis fairytale, but not necessarily generally. Snake features in many tales.)

    Evidently, he only needs to eat one himself.

    I clicked the linky, expecting a perfect godlike website, moderated by the great sages of our age, dedicated to upholding this theory. But it just linked to upthread. I can point you to the FACT that Real Gods ™ do in fact eat Godly Foods ™ (ambrosia, washed down with golden cups of nectar) on a continuous and ongoing basis.

    @ chigau

    murky

    murky ?

  387. chigau (無) says

    I’m just whinging.
    The conversation is hard enough to follow without having it on two threads.

  388. chigau (無) says

    theophontes
    re: Nanking
    Mostly the body-counts.
    They seem to range from negative numbers to over 400,000.
    I agree that the Japanese government needs to make the next move.

  389. Mr. Fire says

    YHWH could have been playing with (“punishing”) His Snake for ages before getting frustrated.

    So apparently Yaweh’s not just a shit, but impotent too.

    And the chaser:

    Surely this should have come up earlier?

    Perhaps that’s what people really mean when they say God is actually Neo:

    “Why oh why didn’t I take the (little) blue pill?”

  390. Beatrice says

    strange gods,

    *sigh*
    I was attempting to somewhat clarify why Giliell got upset and how some of Nepenthe’s comments seemed a bit unfair to me. Since one of my points was that Giliell’s attempts to explain (which at some point became exaggerated) how taking care of her family’s meals, combined with her other responsibilities, was making it difficult for her to change her diet were being dismissed too carelessly, I tried to see what your position on that was. You obviously didn’t read the same thing I did from Nepenthe’s comments.

    If you are only discussing the discussion, without actually wanting to give an opinion on the topic, I really don’t know what we’re supposed to discuss any more. Nepenthe clarified that what Giliell and I (and some others -Holms?) read as condescension was written in honest belief that an average omnivore can’t easily think of a meatless meal. To me personally that’s unbelievable, so I’ll just assign it to cultural differences, I guess.

    I do feel bad about some of the things I wrote, like that mini rant directed at Winterwind.

    —-
    When you relocate a discussion to Thunderdome, could you please give a link on the original thread? I don’t know about others, but I don’t check Thunderdome regularly.

  391. says

    I’m slightly worried that very little of the Liberal Agenda as presented in Liberal Crime Squad is too far for me. Only their version of Free Speech (Which seems to be the ZOMG EVERYTHING IS FINE PERIOD version) and animal rights (Which is that animals are legally people) seems too far to me.

  392. strange gods before me ॐ says

    Beatrice,

    Definitely there are cultural differences. People, like, all the time, it’s one of the most common things I hear about it, ask “what do you eat?”

    Well, you know how people would react or not react if someone said “you shouldn’t buy these brands of clothing because they have awful working conditions. Some would ignore the information, some roll their eyes. But it’s unlikely that there’s going to be a confrontation simply because someone says “it’s hard” and someone else responds here’s how to do it. Even if people think they are being gauche.

    Especially in a related thread. We would not expect “don’t you dare tell me which brands are less bad.” Certainly not on a non-sport blog.

    The degree of disparity in reaction is not reasonable. Side-effect of absorbing the hippie-punching ethos, maybe, but lots of people go cruel quite readily on this topic.

  393. strange gods before me ॐ says

    theophontes,

    We must not forget that Snake goes much further back than Genesis. Snakes are prescient.

    Gonna need Canaanite or similar sources to allow this into evidence.

    I have my pet theory

    On with it! It had better be thicker in the middle.

    ambrosia, washed down with golden cups of nectar

    Lack of mention would suggest he’s not a big fan. (Different pantheons’ gods have different needs. Yahweh does burnt offerings though.)

  396. says

    @ SGBM

    Gonna need Canaanite or similar sources to allow this into evidence.

    Ooooh, Canaanite now?

    {theophontes puts up “dukes”}

    Are you, oh Double-pape ™ going to deny that the Mediteranean, in terms of swapping out religious ideas, was anything but one great big clusterfuck? Or that Zeus was not Norse? But OK. I’ll play along with your little game…

    On with it! It had better be thicker in the middle.

    *cough*
    My theory:
    *cough*
    … by theophontes.

    {cue sound of a bridge}

    That is “theophontes” not “theopontes”!

    Since forever, people have noticed that animals behave in perculiar ways prior to major natural events. These can be prior to spectacular events like the earthquake that clobbered Helice, in Greece in 373 BC (linky). Or the deadly tsunami of more recent times. (linky)

    In the short term you might observe the flight of the swallows, catching insects before an impending storm. But more interestingly Snake heading for the high ground to avoid rainstorms – when there is not a cloud in the sky. For priests of the sky-gods, this is a good trick to keep up one’s sleeve.

    But why Snake and not, for example, mice? Well, there were many mouse observing priests too. Think Apollo Smintheus. Or consider also Thales of Miletus, who observing the behaviour of mice, deduced that there would be a bumper harvest ahead. He bought up every option on every wine-press he could lay his hands on and became very rich very quickly. There are contenders, but in each case above, who has been out there leading the pack? Snake of course!

  398. says

    Curses! I cannot see my cursor in the comment window.

    …

    Lack of mention would suggest he’s not a big fan.

    If YHWH was into apple pie and perry, it does not detract from the idea that gods enjoy their nosh as much as the rest of us. Perhaps YHWH is just a greedy little kid who doesn’t want to share. (Even your heretical “nephelim” theory would back this up. Only that it is power, not peaches that drives his greed.)

    Yahweh does burnt offerings though.

    There is nothing particular in this. But I would point out that the Gods of Olympus and our very own Boltzmann Brontasaurus consume entire hecatombs at a time. YHWH must be a very small god to eat a mere heffer per burnt offering.

    @ chigau

    Like this?

    Like this.

  399. Owlmirror says

    I recently watched a show on animal intelligence (Nova ScienceNow) which stated that the Earth is constantly generating infrasound from the mass of the ocean hitting the crust, and that different locales have a different infrasound background signature (and that pigeons use the infrasound signature to find home).

    Thoughts: What does an earthquake do to the infrasound background, and when (that is, in relation to the more obvious major waves) does it do it?

    Are all animals that panic before earthquakes sensitive to infrasound? Elephants are known to be, and I think snakes are as well.

    Are great apes in general sensitive to infrasound, and if so, why did humans lose it?

  400. says

    @ Owlmirror

    I can’t respond to the infrasound questions (do we have a resident seismologist lurking?). Obviously the earths crust is in a constant process of upheaval and this must be accompanied with vast releases of energy, which may transmit as sound waves as you describe.

    What is interesting is that the Chinese were quite confident they could predict earthquakes by the early 70’s. They used a combination of geophysical instrumentation as well as observations of animal behaviour. This all went swimmingly until 1976, when the Tangshan earthquake struck causing huge loss of life (and changing the course of political history too. It showed up Mao for what he really was – a lousy leader when it came to real problems).

    The instruments failed to predict due to their readings being disparate. On the other hand the animals of Tangshan were bang on target and put up a real show. But went unheaded. Interestingly, there were all manner of signs in the wells and in the skies. Bubbling gas and fireballs (Tangshan is a major coal mining area), rumbling sounds and strange atmospheric effects.

    Surely an old-school oracle would have saved the day.

  401. says

    Stop Press: The Use Of Animals In Earthquake Prediction

    [Snake]

    The Chinese began to study systematically the unusual animal behavior, and the Haicheng earthquake of February 1975 was predicted successfully as early as in mid-December of 1974. The most unusual circumstance of animal behavior was that of snakes that came out of hibernation and froze on the surface of the earth.

    [pigeons]

    The principal focus of research work in China has been on the behavior of pigeons. Biological studies on pigeons determined that a hundred tiny units exist between the tibia and fibula on a pigeon’s leg. These nerve units are connected to the nerve center, and are very sensitive to vibrations. Scientists determined that prior to an earthquake of magnitude 4.0, which occurred in the area of the study, fifty pigeons that had severed connections between the tibia, fibula, and the nerve centers, remained calm before the earthquake, while those with normal connections became startled and flew away.

  402. Beatrice says

    strange gods,

    I don’t know if you expected me to deny it, but yeah, all you wrote is true.

    There were overreactions in the thread. I decided to stick with explaining Giliell’s because I felt I understood why she was getting upset.

    Conversations about veganism/vegetarianism do get people more riled up than, as for your example, talk of sweatshops. But I believe that both sides go into that kind of conversation differently. I wouldn’t find it unreasonable if a poor person got upset into incoherence after being asked to justify themselves for not buying from brands that don’t exploit workers. But they usually don’t get asked that, do they? Expectations about food choices are higher.

    Unless one has a hired cook, there is also a shitton of everyday worries about cooking, depending on individual situations. People get more upset about food, than about other things, but then again, it’s also something pretty important to most of us. Whether you have to worry about eating noodles seven days in a row, feeding your family noodles seven days in a row or taking into consideration different kinds of health problems of your family members when you buy food/cook, there’s some thought and effort you have to put into this every single day. For some people, this requires quite a lot thought and effort. Again, it depends on individual situations, but putting more on top of maybe many things someone has to consider every day, it can get one’s hackles up.

    I’m not denying that things can get very unreasonable, very fast, in these discussions, but I think some reasons behind it are valid.

  403. says

    At atheist conferences we have special guest speakers, perhaps Richard Dawkins or Professor Poopiehead makes an appearance. A comedian or singer might take to the stage to liven things up.

    The goddists in Pakistan have gone one further. They issue special fatwas to get the crowds thronging: Shariah4Pakistan Conference

    I shall attempt to translate the program:


    Teh Pogram:

    1. The problem with the fucking kaffirs.
    2. Declaration of fatwa against the child victim of a shooting. (There will be a intermission of 10 minutes to allow attendees to compulsively masturbate.)
    3. Vindictive character assassination of the founder of our nation.
    4. Two Minutes Hate ™
    5. How to shit on your own carpet: 101.

  405. strange gods before me ॐ says

    I don’t know if you expected me to deny it

    I didn’t have any particular expectation.

    There were overreactions in the thread. I decided to stick with explaining Giliell’s because I felt I understood why she was getting upset.

    Okay. It wasn’t clear earlier that you considered it to be an overreaction.

    Initially I was responding to you in part because that wasn’t clear, and because it felt unfair to me that you were telling just one person that they were being shitty and condescending after they’d been targeted with “thank you for making my point by exactly sprouting that fucking stupid shit I just mentioned”, “fucking stupid bullshit”, “yeah, you’ve just been arrogantly bullshitting”, the false claims that they were “be[ing] an asshole to everybody” and “thinking you could just tell us we’re lazy and stupid” then “fuck you for being a privileged arrogant asshole on this” — and then you joined in the distortions, suggesting that anyone had called you evil, like these uncharitable distortions are totally just a game to play at others’ expense — then more falsehoods, “Right, I put words to the things you expressed otherwise”, “You’re either really stupid or just dishonest”, “you’Re constantly using comparisons and then get all upset when people object to being compared to the KKK”, “My problem are assholes like you who think they know more about me and my life than I do”, and so on.

    I wouldn’t find it unreasonable if a poor person got upset into incoherence after being asked to justify themselves for not buying from brands that don’t exploit workers. But they usually don’t get asked that, do they?

    I would ask you to try to find the comment in that thread where someone is asked to justify themselves. In case you don’t want to, I’ll get to my point right now: it’s very late in the thread and cannot account for the first 80% of comments.

    What usually happens — and what happened in this case — is that some meat eaters treat the very presence of vegetarians who are talking about why it’s wrong to eat meat as synonymous with those vegetarians asking meat eaters to justify themselves. So all talk about ethics is falsely construed as an interpersonal demand, often with an explicit assertion that “you think you’re better than me” or “you think I’m evil”, and then the vegetarians are attacked viciously for making a demand that they didn’t make.

    But those are non sequiturs. If someone says “you should’t buy Nikes”, then that’s what they’re saying: you shouldn’t buy Nikes. This is not synonymous with saying “justify to me your purchase of Nikes”. The difference is important. If some activist wants you to know that you shouldn’t buy Nikes and why not, then they are trying to convey information to you. And if they’re doing so with a public audience besides the two of you, then they are almost certainly trying to convey information to the others as well. There has to be room allowed for this. It is not reasonable to demand that everyone stop saying “X is bad, we should not do X”. Yet, falsely equating “you’re saying X is bad” to “you’re demanding that I justify X” is used as a means of demanding that people stop saying “X is bad”.

    (It actually is okay to ask people to justify their actions which affect others’ interests. But that’s a tangent; my point here is that many, evidently most, pro-veg speakers are not trying to have that sort of discussion. This can and should be recognized by everyone: whatever your opinion about whether other people are allowed to ask you to justify your actions, people who are not doing that should not be responded to as if they are. It’s simply not accurate, and thus it isn’t fair.)

    Also the equation of “X is bad” to “people who do X are evil” should stop. You know that when you’re telling someone “you shouldn’t do that”, like, for instance, “that’s condescending so you shouldn’t say that”, you’re not saying “you’re evil” nor do you believe they’re evil. And if someone says “you should’t buy Nikes” you don’t assume that they believe and are really trying to express the absurd conclusion that “people who buy Nikes are evil”. This same basic charity should apply to discussions about animals’ lives. We can treat people with the minimal decency of expecting that they mean what they actually say, and that they aren’t secretly jumping to absurdly unjustifiable conclusions.

    If we treat every ethical critique as if it really means “you are a fundamentally evil person” then we can’t ever discuss ethics.

    Again, it depends on individual situations, but putting more on top of maybe many things someone has to consider every day, it can get one’s hackles up.

    Instead of assuming that someone was actually “putting more on top of maybe many things someone has to consider every day”, again I would ask you to try to find a comment in that thread where anyone did this.

    What in fact happened was people offered their own reasoning up in a public discussion. Some people are going to discuss some of that reasoning, including critiquing it. This is to be expected. Nobody was being imposed upon. Everyone who participated in that discussion sought it out. They chose to read the OP, they chose to read the comments, they chose to add their own. Heck, if someone wants to add their dubious arguments to a thread and then not experience any critique, there’s even a way to do exactly that: it’s called a driveby comment.

    There has to be room for people to say things like “X is bad” and “Y is better”. If someone else can’t deal with that right now, okay, but that doesn’t justify insisting that the other people should stop talking about it — certainly not when there’s also the easy option of really just not dealing with it, i.e. ignoring those people instead of voluntarily joining the discussion.

  407. says

    @ chigau

    Pakistan was a British colony? It acts as lingua franca, in a country with hundreds of dialects? One of the main speakers is from the UK? It is a show, put on for the media to puff out their inflated egos to a wider audience?

    I find it beyond fucking disgusting that they want to put a fatwa on Malala as a publicity fucking stunt. What is wrong with these people?

  408. strange gods before me ॐ says

    theophontes,

    You want more?

    Are you, oh Double-pape going to deny that the Mediteranean, in terms of swapping out religious ideas, was anything but one great big clusterfuck?

    Yes. It must be something other than a simple undifferentiated clusterfuck if I can say “Canaanite or similar sources please” and you understand why I’m asking for these specifically.

    If you want to introduce other Snake stories into consideration for understanding Genesis, then I want to see persuasive reasoning for doing so. (And I’m indicating ahead of time that the relevance of Canaanite sources is already persuasively reasoned for, and thus others might be argued for by demonstrating a relation to Canaan.)

    I could declare, by papal bull, that Snake might have weather and natural disaster prediction abilities. It would have no implication for Snake’s knowledge of the effects of ToKoGaE fruit. (And if Snake is generally prescient, why doesn’t he do something to avoid being cursed by Yahweh?)

    If YHWH was into apple pie and perry, it does not detract from the idea that gods enjoy their nosh as much as the rest of us. Perhaps YHWH is just a greedy little kid who doesn’t want to share.

    Perhaps a lot of things, but such reasoning proceeds by ignoring what the text indicates is important to the story — in this case Yahweh Elohim’s specific preventive measures against, and lament about, the humans becoming “elohim-like”.

    Even your heretical “nephelim” theory

    See: Rutee and Owlmirror. I haven’t said anything about nephilim.

  409. says

    Tom Gilson, who is a liar for jeebus and has run into our Ebil Oberlawd on more than one occasion, has joined the recent asshattery of the American far-right: Preparing for Persecution

    What is interesting about this person is that he endevours to bring a “scientific/rational” slant to his pressupositions. He spews the same lies as others in his creepy death-cult, but then qualifies them with riders. Peruse the comments on the graph that was sucked out of someone’s thumb.

    (If you are thinking of leaving a comment, bear in mind that Tom Gilson is a hypocritical fuck and will only entertain ideas that are congruent with his own crackpot religious views.)

  410. chigau (無) says

    Did the snake have feet before being cursed?
    If you are already ‘crawling on your belly’ being cursed to ‘crawl on your belly’ is not much of a curse.

  411. strange gods before me ॐ says

    Well, it’s implied to be a change. Anyway there are two more components to the curse: Snake will eat dust, and be despised and attacked by humans.

  412. Beatrice says

    strange gods,

    It’s not fair, really. You can’t just go and write a completely reasonable comment that I can’t really disagree with.

    Ok, I can disagree a bit. Or rather, repeat my attempt at an explanation.

    Instead of assuming that someone was actually “putting more on top of maybe many things someone has to consider every day”, again I would ask you to try to find a comment in that thread where anyone did this.

    I already mentioned how I thought Nepenthe was being condescending. That wasn’t her intention, but that’s how both Giliell and I read it*. It sort of went downhill from there (if we ignore parts with mouse at the beginning and some short skirmishes).

    In the comment before this one, I tried to explain why some omnivores may have reacted as they have. Condescension or making someone feel like they should justify themselves may not have been anyone’s intent (until SC’s comment), but again, I tried to explain why people may be more inclined to read innocent comments that way in this context, while behaving more reasonably in any other.

    I’m aware that I also went overboard at some points. It’s pretty ironic given that I started off with a “we should all try to get along” comment.

    *Nepenthe apparently didn’t believe either Giliell or me when we said that we know how to cook cook things apart from meat, so assumptions all around

  413. says

    @ SGMB

    I want to see persuasive reasoning for doing so

    I have indicated that there is a very Real Life ™ reason why any society can develop a profound understanding of snakes as being prescient. (examples have been provided from divergent times and cultures around the world, these can be multiplied many times over). This abrogates the need for making a specifically Canaanite link. They could generate this understanding ex nihil in little time. Being taken for granted by everyone that works the land (both in terms of practical usefulness and intrusion into general folk-superstitions) this is not reflected in the bible, simply because it was taken as commonplace fact at that time.

    In terms of the “religious clusterfuck” idea: This does have its detractors (for the example of Heracles and the Snake/s) in the case of the Greeks. We know that they travelled extensively to the Levant (which contains Canaan) and that there would be a real measure of interchange of ideas. In fact this is brought up clearly by Robin Lane Fox (Travelling Heroes: Greeks and their myths in the epic age of Homer): The Greeks travelled widely for a time and came into contact with the Levant. They went through a long period of stagnation and then later went back to discover the incredible correlations there with their own myths. They took this in some measure as a vindication of their religious ideas, but in essence they had only rediscovered what they had set in motion in an earlier age (either/both as teachers and/or learners… this last is not completely clear)

    It would have no implication for Snake’s knowledge of the effects of ToKoGaE fruit. (And if Snake is generally prescient, why doesn’t he do something to avoid being cursed by Yahweh?)

    I can see that this would be a problem if Snake was required to be ALL knowing instead of merely knowledgeable. There could be gaps (as there literally are in RL) as to what Snake is capable of being aware of. Also notice that Snake is a master of hiding out. Snake might very well have perused YHWH guzzling fruit and put two and two together. If such details were explicitly covered in Genesis, it would be the size of the babble itself.

    I haven’t said anything about nephilim.

    {thinks: “rats, curses … and other expressions of extreme frustration, why oh why did I have to fluff that one up”}

    Elohim    ish not Nephalimish…

    {tries to hide blushing, slinks off}

  415. ChasCPeterson says

    Snake was already legless, but previously crawled on its back. This helped keep its mouth out of the dust.

  416. strange gods before me ॐ says

    I imagine we’re agreed that to explain is not to excuse.

    If a pro-veg person is approached by someone inviting affirmation for meat eating, they can ignore, disagree with parts, and/or say it’ll get easier in the future. Sometimes the safest thing is to ignore, but even that may be considered rude since they’ve been approached.

    Can we agree it’s not very sensible to approach a pro-veg person who did not approach [generic you], and ask them to say something approving about eating meat? (Can moreover be perturbing?)

  417. Beatrice says

    strange gods,

    Aren’t you simplifying this a bit? There were a couple of parallel discussions going on, with people discussing pro-vegan points and others the opposite. You can’t turn that into “an omnivore asked a pro-vegan person to say something approving about former’s meat eating” as if it came out of the blue, completely out of context.

  418. Beatrice says

    I’m not going to analyze every comment on that thread, so I will only repeat that I have overreacted.

    But don’t you exaggerate the “abused vegans” part either.

  420. jonmilne says

    There’s a very insightful chat between Ricky Gervais and Richard Dawkins that appears on YouTube. Parts of this debate got used in a recent documentary Dawkins has filmed, but this is the full interview. If you have 15 odd minutes to spare, by all means check it out :) :

  421. strange gods before me ॐ says

    But don’t you exaggerate the “abused vegans” part either.

    That’s profoundly unhelpful. Please, either substantiate your claim that I’m exaggerating something — quotes would be nice — or don’t make empty assertions like that.

    I’ll be specific. I’m not calling anything “abuse” here, so I’d appreciate if you don’t put that word in my mouth. And my #416 says nothing about any overreaction anyway; it’s about whether it’s “sensible to approach a pro-veg person who did not approach [generic you], and ask them to say something approving about eating meat”. That’s what it’s about: what’s sensible to expect of another person; not even what’s fair, not anybody’s overreaction, and certainly nothing about “abuse.”

    But, regarding the degree of unfair behavior, since you are suddenly (weirdly) suggesting I’m exaggerating something, let’s be perfectly clear.

    All this: one person being «targeted with “thank you for making my point by exactly sprouting that fucking stupid shit I just mentioned”, “fucking stupid bullshit”, “yeah, you’ve just been arrogantly bullshitting”, the false claims that they were “be[ing] an asshole to everybody” and “thinking you could just tell us we’re lazy and stupid” then “fuck you for being a privileged arrogant asshole on this” — and then you joined in the distortions, suggesting that anyone had called you evil, like these uncharitable distortions are totally just a game to play at others’ expense — then more falsehoods, “Right, I put words to the things you expressed otherwise”, “You’re either really stupid or just dishonest”, “you’Re constantly using comparisons and then get all upset when people object to being compared to the KKK”, “My problem are assholes like you who think they know more about me and my life than I do”, and so on.»

    That was unreasonable, inaccurate, and unfair — and those are actual quotes; I can’t exaggerate them — and there was no equivalent from the other side. There’s my case, succinctly. If you want to try to make the case that someone on the other side was treated as unfairly, you are welcome to show some evidence.

  422. cm's changeable moniker says

    theophontes: “This is the view from my window. It is dark.”

    No, it’s not. That’s what’s keeping you awake. ;-)

  423. cm's changeable moniker says

    Oh, and somewhat related, I recently had an email correspondence with someone from Hangzhou. To my discredit, I didn’t even know Hangzhou was a place, let alone a place with a UNESCO heritage site.

    Globalisation is confusing. I need an atlas. And a drink.

  424. says

    I’m probably not helping, but…

    Both Giliell and hotshoe said in that thread that they disagree with [whatever the hell they in their ignorance understand to be] the arguments for veganism. So they have no desire to become vegans, and the practical question of becoming vegan is pretty much irrelevant.

    Now, I’ll argue with people who put forth arguments against the ethical case for veganism. But what is the point of arguing with someone who fundamentally disagrees with [their understanding of] that case but wants to dwell on alleged practical difficulties? Especially when they can keep noting (or inventing) conditions at will, and no one can make the contrary case for their specific situation?

    In what world is that valid? Should I spend my time arguing about the difficulties of finding designated drivers and drinking in locations without adequate public transportation with people who don’t agree with arguments against driving drunk, with the principle that we collectively should avoid it and find solutions that collectively avoid it? Or should I address the people who share my values but are looking for practical solutions? I think the latter.

  425. says

    @ cm’s

    That is a veritable blackout by Shenzhen standards.

    Hangzhou

    {with mock disdain}That little hick town. (Don’t worry, most people likely don’t know Shenzhen exists.)

    @ Chas

    Oops, I forgot to mention that turtles and totoises are prescient also.

  427. strange gods before me ॐ says

    Rereading 421 “it looks like fighting” but I don’t want that. Meh. I said I should shut up.

  428. says

    @ chigau

    {theophontes, in tone of great munificence}
    Here, have an “r”. Oh to hell with it, let’s go large: Have an “R“!

    (I am sure that toRtoises in Kansas are also “prescient”.)

  430. Owlmirror says

    So, I hit Google Scholar for [snake cult Levant], and trudged through the hits.

    Alas, it looks like many of the refs are simply not online.

    Still:

    To be sure, snake figurines and other items with snake motifs have been found at Tel Kinrot (Faßbeck et al. 2003, 50- 51 with Abb. 83a-b), Hazor (Yadin 1960, pls CCCIX, 8 and CCLXXVIII, 20; cf. the bowl onto the body of which a clay-sculptured snake was applied; see Yadin et al. 1961, pl. CXCVI, 13 and Yadin et al. 1989, 223; Keel 1992, 234, Abb. 186), and many other sites (see the inventory of the Syro-Palestinian snake iconography in Keel 1992, 195-266; see also Buchholz 2008), demonstrating that the snake was a prominent religious symbol even in the Early Iron Age in the Southern Levant as in the Near East in general [24].
    _______________________________________________
    24 The evidence is compiled by Koh 1994; according to his inventory, the number of sites with snake objects decreases dramatically from the Late Bronze Age to the Iron Age. Generally on the topic, cf. Buchholz 2000. For a more distant Iron Age example from the Gulf area (ancient Oman), see Benoist 2007.

    Refs :

    Buchholz, H.-G. 2000. Furcht vor Schlangen und Umgang mit Schlangen in Altsyrien, Altkypros und dem Umfeld. Ugarit-Forschungen 32, 39-169

    Buchholz, H.-G. 2008. Bemerkungen zur ostmediterran-vorderasiatischen Schlangen-Ikonographie. In S. Bar (ed.), In the Hill-Country, and in the Shephelah, and in the Arabah (Joshua 12,8): Studies and Researches presented to Adam Zertal in the Thirtieth Anniversary of the Manasseh Hill-Country Survey, 56*-69*. Jerusalem:

    Faßbeck, G., Münger, S. and Röhl, S. 2002. Gotteshaus und Hausgott – Ausgewählte Hinweise auf möglichen Hauskult im antiken Kinneret. In G. Faßbeck, S. Fortner, A. Rottlof and J. Zangenberg (eds), Leben am See Gennesaret. Kulturgeschichtliche Entdeckungen in einer biblischen Region, 47-51, 207. Mainz: Philipp von Zabern Verlag

    Keel, O. 1992. Das Recht der Bilder, gesehen zu werden. Drei Fallstudien zur Methode der Interpretation altorientalischer Bilder. Orbis biblicus et orientalis 122. Fribourg and Göttingen: Universitätsverlag Fribourg and Vandenhoeck & Ruprecht

    Koh, S. 1994. An Archaeological Investigation of the Snake Cult in the Southern Levant: From the Chalcolitic Period through the Iron Age. Unpublished PhD thesis submitted to the University of Chicago

    Yadin, Y. 1975. Hazor. The Rediscovery of the Great Citadel of the Bible. London: Weidenfeld and Nicholson

    Yadin, Y., Aharoni, Y., Amiran, R., Dothan, T., Dunayevsky, I. and Perrot, J. 1960. Hazor II. An Account of the Second Season of Excavations, 1956. Jerusalem: Israel Exploration Society

    Yadin, Y., Aharoni, Y., Amiran, R., Dothan, T., Dothan, M., Dunayevsky, I. and Perrot, J. 1961. Hazor III–IV. An Account of the Third and Fourth Seasons of Excavations, 1957-1958. Plates. Jerusalem: Israel Exploration Society

    Yadin, Y., Amiran, R., Ben-Tor, A., Dothan, M., Dothan, T., Dunayevsky, I., Geva, S. and Stern, E. 1989. Hazor III–IV. An Account of the Third and Fourth Seasons of Excavations, 1957–1958. Text. Jerusalem: Israel Exploration Society

    Link for above:
    http://www.kinneret-excavations.org/download_files/nissinen_muenger_fs_van_der_kooij_2009.pdf

    Some of the hits had some amusing speculation, like seeking to identify Dionysus with Yahweh, at least partly through shared snake-imagery.

    b. Common Symbols
    Snakes. Dionysus is surrounded by snakes: the god is born in a nest of serpents. As a boy, he is generally shown holding serpents, and later, he is symbolized as a mythical snake.18 The cult of Dionysus also involved the handling of snakes by Maenads, confirming his intimate association with this animal.19 Sabazius, the Thracian homolog of Dionysus, was also symbolized as a snake and this reptile played a central role in his cult.20 Yahweh is also described as surrounded by burning snakes (seraphim) by Isaiah (6.1-3), and flying snakes are sent by Yahweh against the enemies of Israel (Isa. 14.29). Here again, this association is devoid of any specific significance in a monotheistic context, where Yahweh reigns over the whole Universe. Nevertheless, the fact that the transformation of a staff into a snake (Exod. 4.1-5) is considered as the specific sign ensuring that Moses speaks in the name of Yahweh suggests that Yahweh is ore closely related to snakes than assumed by the monotheistic exegesis. This point is corroborated by the worship of Yahweh as a bronze snake (nehushtan) in Jerusalem, until the religious reform of Hezekiah.21

    hmph.

  432. says

    Therefore the “” in the above. (In principle I agree with you though.)

    I use the word in the sense of how they may be perceived by an earlier age. The animals appear, as if by magic to know what is coming, be it storm or earthquake. It would appear to an ignorant (by our lights) observer that they are indeed prescient. In terms of our discussion of Snake, we complicate the argument for this perceived prescience by imposing from the outside, as it were, knowledge that humanity has gained only very recently (and only in part).

    The whole Snake story is complicated by being in onion-like layers:

    1. The story of Genesis (which in itself can be read on different levels).
    2. The local historical context in Canaan.
    3. The impact of cultures and circumstances outside of the area in question.
    4. The global realities, impinging on all of the above, that we now know.
    5. … and (obviously we are learning more all the time, also we should add a “0.” above. Genesis likely grew out of much earlier oral traditions.)

    Consider Snake’s “prescience” in each level in turn:

    0. Prescient.
    1. Prescient.
    2. Prescient.
    3. Prescient.
    4. Reactive.
    5. Reactive (I shall stick my neck out here.)

    We now know the situation is like the brontosaurus. Whereas snake was aware of the whole brontosaurus, mere humans were only aware of the fat middle bit. They simply could not perceive the thin bits at either end, so that their awareness only began when matters were upon them. With science we can now get to the neck. In future we shall feel the breath on its nostrils and breathe a sigh of relief.

  433. says

    @ Owlmirror

    Trying to lead the minions astray again, Owlmirror?

    (There is also the Dionysus —> Jeebus —> YHWH angle but sadly, AFAIK, without Snake.)

    @ dysomniak, darwinian socialist

    Alan Moore has some interesting opinions on snakes

    And here I sit without access to youtube. :'(

    @ SGBM

    My PC conked out recently so I lost TOR. I could reload the file you sent, but have forgotten the passwords to download it. Do you recall? Some characteristic of tardigrades?

  434. Beatrice says

    If a pro-veg person is approached by someone inviting affirmation for meat eating, they can ignore, disagree with parts, and/or say it’ll get easier in the future. Sometimes the safest thing is to ignore, but even that may be considered rude since they’ve been approached.

    This can be read as implying some sort of danger of abuse from the person approaching them. You didn’t mean that? Ok then, good.
    I’m reading too much between the lines. I sometimes do that.

    I already wrote everything I intended to write about this. I don’t know what the hell you want from me. I didn’t write “both sides were equally wrong”.

    It’s really great if you can go through 450+ comments thread and discuss it for days afterwards, but I can’t. Well, I probably could, but I really don’t want to.

    I’m going to disengage from a conversation I don’t want to be a part of any more, since no one is forcing me to argue.

    So, I’m shutting up about this. There will a ve*n thread again sooner or later and then we’ll see how discussions go.
    I’ll try to do better, or ignore the whole thing if I feel shouty.

  435. Owlmirror says

    (There is also the Dionysus —> Jeebus —> YHWH angle but sadly, AFAIK, without Snake.)

    Or so one might think. Yet the snake sheds its skin, and is thus a brilliant symbol for a dying and resurrecting god.

    I suspect that the snake may have been associated with Asherah rather than with Yahweh, and so perhaps Genesis 3 was part of the campaign by Yahweh monolatrists to divorce Yahweh from Asherah and all of the symbols of Asherah.

    Which explains how Snake knows what the fruit of the ToKoGaE will do and not do — he was hanging out with Asherah.

    Referencing this:

    This point is corroborated by the worship of Yahweh as a bronze snake (nehushtan) in Jerusalem, until the religious reform of Hezekiah.

    I read another text in Google Books that describes the Ugaritic pantheon of which Yahweh and Asherah were once part, and explains it as a multilevel hierarchy, with the highest god (or gods) at the top, lower gods (and the “sons of the Gods” of Genesis 6 are suggested as being such lower gods), and messengers/slaves of the Gods at the lowest rank. The text identifies nechushtan as being an example of just such a low-ranking messenger/slave God; not Yahweh himself, but an intermediary assigned to handle snakebite cases on Yahweh’s behalf.

  436. says

    @ Owlmirror

    the snake sheds its skin

    Further: The snake also hibernates. Ie it goes underground into the realm of the dead and their cthonic rulers for winter and is therefore an ideal symbol for a year-god. (goddists get irate when you remind them jeebus is a year-god)

    Asherah

    It is easy to forget that there was ever a matriarchy and that the priestess held more power than the king. With the rise of the patriarchy all these godesses and their symbols would have to snuff it too. Snake would inevitably become demonised.

    a multilevel hierarchy

    A very good point to raise. Religion was much of a multi-nested heirarchy that extended from the heavens all the way into the household. YHWH and his Asherah would be seen in the king and his priestess/queen would be seen in the husband and his wife.

    The whole idea of “Lord” also gets found in the king and in the landowners. His (in the patriarchy) word, on any level, would be absolute. Sin would be any challenge to this order and the evil must be rudely beaten out. (Spare the rod and spoil the child. There are no such things as “mistakes” – error is indicative of Teh Ebil ™ and must be physically removed.)

  437. says

    We must not forget that Adam only hit it off with Eve after his torrid affair with Lilith ended. Lilith went on to live in the desert with all her pets, including arrow snakes. Interestingly, KJV and a few other bibles get this all wrong:

    There shall the great owle make her nest, and lay and hatch, and gather vnder her shadow: there shall the vultures also be gathered, euery one with her mate. — KJV Isaiah 34:15

    (My emphasis, not Isaiah’s)

    Nowadays we know he really meant Snake (notice it is Mrs Snake and her kids):

    There shall the great owl – (קפוז qı̂pôz). Gesenius supposes that this is the arrow-snake, so called from its darting or springing, in the manner of the rattle-snake – from an obsolete root to draw oneself together, to contract. Bochart (Hieroz. ii. 3. 11. 408-419) has examined the meaning of the word at length, and comes to the conclusion that it means the serpent which the Greeks called acontias, and the Latins, jaculus – the arrow-snake. The serpent is oviparous, and nourishes its young.

    Linky.

    Under her shadow – This might be done by the serpent that should coil up and cherish her young.

    Not only is Snake a beautiful serpent, she is also a loving and caring parent.

  441. Owlmirror says

    Lilith as Adam’s first wife is actually much much later; from Babylonian mythos interwoven with Hebrew midrash .

    Don’t confuse midrash with what the original authors and audience had in mind.

  442. Dhorvath, OM says

    SG,

    What usually happens — and what happened in this case — is that some meat eaters treat the very presence of vegetarians who are talking about why it’s wrong to eat meat as synonymous with those vegetarians asking meat eaters to justify themselves.

    This troubles me. I do this, or at least I think I do. When a group or person talks about the problems with something I do, I will join their conversation with some of the reasons that I continue. And in an example of basically the very thing you are saying is unfair, I feel inclined to defend acting that way.

    What we do matters to a lot of people. Being exposed to people who think our behaviour should be avoided, not just as a matter of taste, but in an imperative manner, is an injunction regarding our behaviour. It may not be successful, but it is at the least playing some role in our future decisions. Reacting to that is not wrong.

  443. Owlmirror says

    Adam’s First Wife: The Story of Lilith

    Fiddlesticks.

    Midrash is not about finding sekret characters that were removed; it’s about backfilling and making stuff up (or importing from other mythos, sometimes) to explain discrepencies that arise because the bible is not a unified coherent narrative written by one author with a clear narrative vision.

    Genesis 1 is a Priestly narrative, describing the actions of a lofty high God, speaking and commanding the earth to obey, which it does.

    Genesis 2 is an earlier Yahwehist story, about a more hands-on and human-like god making men from mud and women from a rib.
    (which may result from a confused taleswapping from the Sumerian)

    Ninhursag: “My brother what hurts thee?”
    Enki: “My side hurts me.”
    Ninhursag: “To the goddess Dazimua I give birth for thee.”
    Ninhursag: “My brother what hurts thee?”
    Enki: “My rib hurts me.”
    Ninhursag: “To the goddess Ninti I give birth for thee.”
    (Kramer, Sumerian Mythology 58)

    Each of the eight healing deities has a name that sounds like the name of the body part that needs healing. Kramer finds one of these double names to be significant:

    Now the Sumerian word for “rib” is ti (pronounced “tee”). The goddess created for the healing of Enki’s rib, therefore was called in Sumerian Nin-ti, “the lady of the rib.” But the very same Sumerian word ti also means “to make live.” The name Nin-ti may thus mean “the lady who makes live,” as well as “the lady of the rib.” In Sumerian literature, therefore, “the lady of the rib” came to be identified with “the lady who makes live” through what might be termed a play on words. (Kramer, Mythologies 103)

    Kramer suggests that the passage in Genesis where Eve, “the mother of all living” is taken from Adam’s rib may be an echo of this Sumerian pun, though he is quick to point out that “the Hebrew word for ‘rib’ and that for ‘who makes live’ have nothing in common” (Mythologies 103). I suppose it is possible that Eve (“life”) was taken from Adam’s rib (and not some other body part) because of some dim recollection of this Sumerian rib / life pun. I should note, however, that in the Bible the two terms are separated: Eve is created from Adam’s rib at Genesis 2:21-24, but she does not receive her “life” name until Genesis 3:20.

  444. says

    @ Owlmirror

    Do you mean the replacement of “Lilith” in the bible was in error because it did not mean what the Marians thought it meant? (a bird mistranslated as demon/woman falsified back to a bird)

    (I have just finished drinking a bottle of “Hemp Seed Deluxe with Oat Drink”. I trust it is not affecting me.)

    ….

    Interesting Link: The scopes trial set out as part of a law sylabus. To skip to the bit about genesis go here. (I downloaded Inherit The Wind a while back and watched it again recently. I must try and find the link to share.)

  447. says

    @ Owlmirror

    I pressume you meant by:

    Midrash is not about finding sekret characters that were removed

    This:

    In developing the Midrash to explain Lilith’s presence in the Bible,

    I thought that particular inferrence referred to Isaiah’s (34:15) Lilith, not creating a Lilith from thin air. They are considering her presence in the babble. Why would they need to explain things (sekret characters) that were not there (removed) anyway?

  448. Owlmirror says

    Do you mean the replacement of “Lilith” in the bible was in error because it did not mean what the Marians thought it meant?

    No, I meant what I wrote: That Lilith was only thought of as being Adam’s first wife as the result of much later mythological conflation, and cannot really be claimed to be a “discovery” of something that was redacted/omitted.

    I was not referring to the translation of Isaiah 34:14, although I will mention, yet again, that Isaiah is a damn weird book with many strange and hard-to-decipher words and phrases.

    I mistrust the source you link to, though. I call bullshit not just on his etymology of “lullaby”, but also on his biology. The restriction of “screech owl” to the New World is the result of modern ornithological nomenclature. I insist that there are plenty of owls in the old world that make vocalizations that could be called screeches, and precise organization of those owls into modern phylogenies where their names do not include “screech” is very recent indeed.

  449. says

    @ Owlmirror

    Rage at linguistic bullshit rising… rising…

    Aaaaargh!

    Aaaaaaaargh!

    That post was very much a cut and paste job. Some good, some bad. I recognise where some issues raised are coming from, others are obviously of dubious origin. (I am new to and intrigued by the whole Marian story.)

  450. chigau (無) says

    Rage at linguistic bullshit rising… rising…

    owlmirror
    ‘owl’ was originally ‘wol’ onomatopœia from the call of the rare diurnal owl Aegolius bafflegabus.
    ‘mirror’ was originally a palindrome ‘mirrim’ but a typesetter got drunk.
    (This is fun!)

  451. cm's changeable moniker says

    In completely unrelated news, I won on the Euromillions lottery! After subtracting the price of the ticket, I am now £0.60 richer. (Americans, that’s about what you would call “a buck”.)

    I’m not sure it was worth the walk to collect it, but damn, it’s something. ;-)

  452. cm's changeable moniker says

    In totally unrelated news, I have had a bit of a lightbulb! moment.

    The misbehaving laptop (on which I’m typing) only misbehaves when put into sleep mode by closing the lid. If I shut it down properly (using the wildly unintuitive Start menu), it’s fine. So … I now suspect that the damn thing thinks the lid is closed even when it’s reopened, and the power button (this is me: on! off! on! off!) is being ignored until I leave it for a while and then open it *more carefully*.

    Experimental data will be acquired. If I’m right, it might even get reported.

  453. carlie says

    cm – I’m sure this is what you’re doing, but you could go into the power settings and change it to not go to sleep at all when closed, and see if that resolves the problem.

  454. strange gods before me ॐ says

    Beatrice,

    I assume you saw my 427. I don’t want anything from you. I sort of want to answer certain sentences and I sort of want to shut up. Time will tell. If I don’t shut up, it doesn’t mean that I feel like you have to reply to me. I understand not wanting to continue a conversation, and I do it all the time. I don’t think you have my email address: this or this will work.

    +++++
    Dhorvath,

    This troubles me. I do this, or at least I think I do. When a group or person talks about the problems with something I do, I will join their conversation with some of the reasons that I continue. And in an example of basically the very thing you are saying is unfair, I feel inclined to defend acting that way.

    Well, I’m not trying to complain about people merely wanting to defend what they do. If people want to do that that’s understandable and arguably rational. What I mean to specify is, in addition, declaring that you have a problem with the way you’re being made to defend yourself, when you aren’t in fact being made to defend yourself. And I’m using that as a segue for a tone argument. I know! But being a hypocrite doesn’t mean I’m wrong about this: haterade based on inaccuracy is to be avoided.

    Being exposed to people who think our behaviour should be avoided, not just as a matter of taste, but in an imperative manner, is an injunction regarding our behaviour.

    Injunction though? [checks dictionary] I dunno. Do you feel like “boycott Nike” person is giving you an injunction? Whatever you want to call that, people generally react approximately reasonable when told they shouldn’t buy some brand. I am suggesting that type of reaction is also appropriate for people talking about veganism.

    +++++
    theophontes,

    There’s a new version. 32 or 64 bit?

  455. says

    @ SGBM

    Both machines (PC and laptop) are 64 bit. I am running Ubuntu 12.04.

    Muchas Gracias!

    {pours further libations to Teh Boltzmann Brontosaurus, toasts the health of Mrs Snake and her family.}

    I am still on theophontesAThotmail

  456. Dhorvath, OM says

    SG,
    Thanks for clarifying. It’s the degree of vehemence that is notable, not that there is response.

    As for injunction, I can see it’s not the best word to convey the notion. I didn’t want compulsion, it’s too strong for what I meant, but I didn’t want to discount that it is an influence. When people start talking about ethics and morals they are drifting into should and ought territory, not can and might. The dialogue differs, at least for me, and based on my experience for other people as well. So when a person says “Don’t buy Nike”, it’s possible that they had a bad experience with the product, but when they say “Don’t buy Nike, because they rely on the labour of children” there is an ought, or several, tied up in their statement, (that children shouldn’t be employed in making corporations or their elders wealthy for example.) Hearing about things that a company/industry does that I think shouldn’t be done has an impact on my future inclination to support them, injunction seemed to fit, but now I am wishing I had used some other word instead.

  457. rq says

    To all of those having the Yahweh-Snake-Genesis-etc. discussion, thank you! It’s quite fascinating. All kinds of things I never knew. (You have secret readers, is what I’m trying to say. ;) )

  458. strange gods before me ॐ says

    theophontes,

    After I asked, I thought, why don’t I just send both. So I started uploading this last night. Download it if you can, and let me know when you’ve got it saved. If you can’t download it then we’ll try email.

  460. says

    @ rq

    Yahweh-Snake-Genesis-etc. discussion

    I blame Owlmirror, sockpuppet of Rebecca Watson.

    @ SGBM

    Our tardigrade has been disappeared? :(

    No, just been struggling to renew my resident’s visa for China. I had to spend a whole week on the mainland to get it. Obviously they have not put my escapades with Jeebus into my PSB files.

    Thanks for the linky, I’ll try fixing that this weekend. I’ll give you a shout if I get stuck.

    We have fans of our Snake disputations. Time to step up to the plate again Your Papieness.

  461. says

    Hours to stop Uganda’s horrific anti-gay law (Link here)

    Sometimes I feel ambarassed to be African. Rather than reminding me that that is silly, please follow above linky and add yourselves to the petition.

    (There will be a special tardigrade dance if the petition gets pharyngulated over a million.)

  466. strange gods before me ॐ says

    theophontes,

    Downloaded the file, but it needs a password.

    Yes, the “download first, then receive password” protocol is my quick and dirty layer of protection against MITM.

    Your password is:

    TheTa,rdigr>adeId\entit/y

  467. jonmilne says

    Hey guys, another debate I’m having, but this one’s actually against someone relatively big, albeit only big enough to warrant a passing mention on RationalWiki’s entry on Potholer54. Anyhow, a search for Juby on FTB yielded nothing, so I figured Juby was due a bashing.

    Anyhow, long story short, Juby’s gotten pissed that I called him out on his crap. Specifically, he believed that evolutionary theory not only had zero impact on medical advancements and science, but also had a detrimental effect that was apparently demonstrable (and he actually cited vestigial organs, junk DNA, and the origin of Planets and the Moon as evidence for his claims… Yeah), and he also tried to use Edwards vs Aguillard as proof that Creationism deserved a place in the classroom, only for me to school him in exactly what the ruling and happenings were in that case, and how it relates to the sealed fate of ID/Creationism in Kitzmiller v Dover, and I gleefully pointed out just how badly ID advocates got completely owned on the stand.

    Well surprise surprise, he threw a tantrum, saying that K v D doesn’t prove anything (convenient, that) and he asserted that the Prosecution’s witnesses lied on the stand (with no evidence for this in the way that there’s evidence that Behe and Bonsell definitely lied on the stand).

    He also got angry because when he asserted that “religious people who believed in theology helped build the foundations of modern science”, I pointed out that such people existed at a time when a) they would have had to have been religious to even receive any form of education, and b) anyone openly atheist and contrary to the Creation story belief would have been killed on the spot, and c) he’s still ultimately relying on both Biblical Inerrancy and the word of people who were ignorant about what science would be able to discover.

    After he finished his tantrum accusing me of dishonesty and willfully peddling false information (I wasn’t) he then linked me to his site which he claimed rebutted my beliefs about evolution, specifically pointing me to Section 5: “More Chimp and Human DNA Stuff” as evidence for his claims. The link is here: http://ianjuby.org/newsletter/?p=489#5 As someone who isn’t entirely the best in terms of “scientific” stuff, I’d appreciate any help here with what he claims in that section.

    Much thanks,

    Jon

  468. says

    @ SGBM

    MITM

    Huh?

    {tap,tap,tappity,tap …. poyt!}

    “Man In The Middle …Janus attack”

    Good that you brought up Janus. There is a story of Adam and Eve that had them conjoined back to back. (Should we only be sticking to the more catholic stories of Genesis? There are some interesting little sidetracks off the garden path.)

    … and thanks for the pswd!

  469. chigau (無) says

    Didn’t Plato have some notion of primordial back-to-back entities?
    male-male, female-female, female-male
    The Gods split them and now we all spend our lives seeking the primordial ‘other half’

  471. chigau (無) says

    Ing
    Do you have a link to something online?
    I dredged that up out of something I read almost 40 years ago.

  472. says

    @ chigau

    There are also very old Jewish stories as such. I shall have to dig a little bit. If you are following SGBM and my latest conversation, you might notice:

    Janus —> Janitor —> Tor (I raise this point only that you might want to tease the Public Enemy Number One ™ a little.)

    @ SGBM

    I am mailing this via a browser that has a little green onion in the corner.

  474. jonmilne says

    Specifically, the part I’d like help with is this:

    5) More Chimp and Human DNA stuff

    Now that the chimpanzee genome has been unravelled…..wait – you didn’t know that it had not been unravelled? Oh – you’ve probably heard the claims made for over a decade now about how humans and chimps share 98.4% of their DNA huh? Yup, such claims were made with very little of the chimpanzee genome actually decoded! It’s like reading one book, then reading the first page of a completely different book and saying the two books were almost identical.
    Unfortunately, that analogy holds true in far more ways than one realizes. Not only did the evolutionists who made this claim have very little of the chimp’s “book,” to compare to the human “book,” they ignored huge portions of the parts of the book that they did have!

    So last year the chimpanzee genome was finally decoded and made public – yet strangely the evolutionary community was quiet on many aspects of the genome. Presumably because of all the unexpected contradictions to the evolutionary theory that were being discovered.

    First of all, coming back to the “Human and Chimpanzee DNA is 98.4% identical” claim, as I mentioned in a previous newsletter (“Meet your relative, the sponge”), we only had an estimate
    of the length of the chimp DNA – which was around 10-15% longer than the human DNA. We now know it’s about 12% (you can download, view and compare the DNA sequences of multiple critters here: http://hgdownload.cse.ucsc.edu/downloads.html). So how then can the chimpanzee and human DNA be 98.4% identical when one is 12% longer than the other?

    The 98.4% figure (or 99%, depending on who you ask, obviously the number doesn’t matter because it’s ludicrous) was arrived at by ignoring huge portions of each DNA. You have to dig to find this out and get the evolutionary “researchers” to admit this. But it gets worse. To understand this, let’s do a little crash course on DNA and chromosomes.

    Crash course in chromosomes:
    Chromosomes are bundles of DNA. Humans have 23 pairs of chromosomes, and each chromosome contains unique DNA. Two of the chromosomes are linked to gender, known as the X and Y chromosomes. Women have two X chromosomes while men have one X and one Y chromosome. If you were to unwind the DNA in each chromosome, all of it put end to end makes up your genome, or your entire genetic code (DNA).

    Male human chromosomes

    The DNA is made up of four chemicals which are represented by letters A, G, C, and T. These four letters in sequence make up the instructions on how to build you. Sequences of these letters contain specific instructions to do specific things (like making an arm for example), and these sequences are called genes.

    So now to compare chimp DNA and human DNA, the evolutionary researchers lay the chromosomes of the two critters side by each to see how the letter sequences and genes line up.

    In short, they don’t line up.So this is where some rather… *ahem* creative liberties are taken to make the comparisons. The evolutionary researcher will find the gene that codes for say, the appendix in the human DNA, and they will find the gene that codes for the appendix in the chimp DNA and compare them. While it should come as no surprise that they’re similar, you’ll please notice they have just ignored some 99% of the entire DNA to make one comparison. And all too often that comparison arrives at figures of 98.4% identical – which should come as no surprise to an engineer.

    You see, as a robotics engineer, I’ve had people spontaneously say that they can recognize a robot I built by its design. This is because what works on one robot, works on another completely different robot. So I use the same design and parts on different robots. This is efficient design and has nothing to do with one robot evolving into another! This is evidence of a common designer.

    The fact that two completely different robots have the exact same gripper would be called a homology, or a homologue.

    So yes, you will see homologues in life – we creationary thinkers would say it’s evidence of a common designer, not a common ancestor. In fact, to use the robot analogy some more before we actually compare the chimp and human DNA, let’s say I use the exact same robotic gripper on two robots: One is a land roving robot, the other is a submarine robot. The land rover has the gripper attached to the end of a robotic arm, but the submarine has it attached to the frame, to grab things to hold the robot in place.
    So while both robots have the exact same gripper (evidence of a common designer), the location of the gripper is completely different (which is good evidence that one robot didn’t evolve into the other ).

    This is, in effect, what we see when we compare the chimp and human genes, and you can look at the comparisons yourself on the ensembl website.

    You can get a wonderful tour of what I’m going to talk about here by youtuber Hugenex2000:
    http://www.youtube.com/watch?v=Ey5MuAgLWd8&feature=player_embedded

    The big chromosome up the middle of the image above is a human Y chromosome. The chimpanzee Y chromosome, for comparison, is in the upper left. The first problem you’ll notice is that the graph actually shows two other chimpanzee chromosomes. Why? Because the gene in the human corresponds to the gene in a chimp on a completely different chromosome!
    So not only are the genes different from each other, they are in radically different places – like the robots having a similar gripper in completely different locations. In fact, take a look at the lines connecting the genes from the chimpanzee Y chromosome (upper left) with the human Y chromosome, and you’ll notice that the genes are in completely different locations.
    Chimpanzees and humans were supposed to have evolved from a common ancestor, and therefore the genes should be in relatively the same places between the organisms. But they are not even close! The order is completely switched around. This is supposed to be “98.4% similiarity.”

    ORFan genes:
    Scouting around in ensembl, in the bottom right hand corner, click on “15 downstream genes.” This will list the first 15 genes in the human and chimpanzees.
    You’ll notice right off the bat that the first four genes in the human have “no homologues” in the chimpanzee. In other words, these genes are unique to the human. These are called Orphan genes, or ORFan (for Open Reading Frame). Chimps and humans both have hundreds of orphan genes. The orphan genes have a 0% DNA match between humans and chimpanzees – but you never hear about that when the anticreationists cite the similarities between human and chimp DNA as evidence for evolution, do you? That’s because it doesn’t help evolution – in fact, it poses another challenge for evolutionary theory: If evolution works by “descent with modification,” HOW did so many unique genes arise in each species?
    This is an especially important question when you realize that a lot of these orfan genes are crucial to the organism’s survival!

    Forget cold fusion – we got chromosome fusion!
    Just as bogus as the 98.4% similarity claim, some evolutionists have also claimed that the common ancestor of the chimp and human had 24 chromosomes, and two of the ancestor’s chromosomes “fused” together into one chromosome somewhere along our ancestry, which is why humans only have 23 chromosomes.

    At the alleged fusion location, it was claimed there were found telomere sequences. Telomeres are at the very end of the DNA chain in a chromosome, and it’s like a marker to show the DNA-reading equipment where the end is, and to protect the DNA from fragmentation at the more vulnerable ends of the DNA. Telomeres are simply thousands upond thousands of repeats of six of those letters that make up the DNA, like this:

    CTGAGATCCCGCGTTAGGGTTAGGGTTAGGGTTAGGGTTAGGG…

    The first telomere sequenece (TTAGGG) is marked in purple, and you can see it repeating in red. This continues on for usually many thousands of repeats at the end of the DNA.

    So, the evolutionary community claimed there was a telomere sequence right smack dab in the middle of the human chromosome 2, right exactly where evolution predicted if the two ape chromosomes (named 2A and 2B) had fused.

    This claim was promoted quite a bit by theistic evolutionist Dr. Ken Miller, who brazenly promulgated the claim in spite of the evidence against it.

    For example: when did this fusion occur? How did the 24 chromosome sperm fertilize a 23 chromosome egg, or vice versa? We’re talking extinction of the species here, so this is obviously an important question that Miller and the fused chromosome supporters have swept under the rug!

    Anticreationists are frankly quite cocky with this claim, as can be seen by a video posted as a response to a video I have on my channel, a debate between Laurence Tisdall and Jason Wiles, on the Michael Coren show.
    The skeptic’s video is entitled “How to shut up pesky creationists.”
    http://www.youtube.com/watch?v=dK3O6KYPmEw&feature=related&fb_source=message

    Unfortunately for the skeptic, it doesn’t shut me up, in fact, I’ll be posting my own video response to his video shortly.

    Chromosomal fusion zombie – dead long ago, but still wanting to eat yer brains…
    Evolution and the chromosomal fusion claim are very much like a zombie: Already dead, walking, and wanting to eat your brains.
    Enter Dr. Bergman and Dr. Tomkins, zombie slayers extrodinaire. :)
    Their article which came out this fall utterly destroyed the chromosomal fusion claim once and for all. (Journal of Creation, Volume 25, issue 2, fall 2011, “The chromosome 2 fusion model of evolution: re-evaluating the evidence.”)

    In that article (and a layman’s article synopsis by Dr. Tomkins), they lay out all the nails with which they seal the coffin of the chromosomal fusion zombie:

    There is no telomere at the alleged fusion site:
    -at the alleged fusion site there was only found a sequence which was vaguely akin to a telomere sequence, with lots of differences to regular telomere sequences, and it was too short!

    The telomere sequence was in the wrong spot:
    -there was, however, a very nice “telomere sequence” found waaaay down the DNA chain – far away from the alleged “fusion site”

    Nearly every chromosome had a “fusion site”:
    -obviously telomere sequences in the middle of a chromosome does not indicate a fusion, because nearly every human chromosome had alleged telomere sequences in the middle of it! Obviously, there’s more going on here than meets the eye.

    No corresponding DNA sequences:
    -if the human chromosome 2 was the result of 2 ape chromosomes fusing, then there should be sequences on either side of the “fusion site” that match the chimp DNA, right? This was not the case – the DNA sequences on either side were quite different than the chimp sequence.

    There’s much more to this subject, but I’m trying to keep this article short and relatively simple. If you want to wade into the technicalities of this fascinating subject, you can look up the references and read until your brain explodes….and the zombie eats your brains….

    Some more reading:
    http://www.uncommondescent.com/intelligent-design/why-the-chromosomal-fusion-argument-doesnt-wash/

    http://ianjuby.org/newsletter/?p=489#5

  475. says

    @ A.R

    This was going to be inevitable and I have seen it coming for a while. Then yesterday a friend told me that George Lucas took twenty (20) years to get Star Wars together. What with all that high-tech that he needed. I don’t even know if this is true. I just realised it seems far too easy to believe.

    So anyway, some good news and some bad news concerning TPM:
    The bad news: It would take me forever to put the entire movie together with free software, and by myself.
    The good news: Our endeavour will continue, but by getting back to old school basics. Instead of a digital CG tardigrade, we will make do with the real thing. The digital microscope has been purchased today (“pix or it didn’t happen” ). Unfortunately the scientific supplies company is shut on weekends, so I can only get the other bits during the week. But we’ll get there. (Eventually.)

  476. says

    @ chigau

    The Gods split them and now we all spend our lives seeking the primordial ‘other half’

    DNA, chigau, DNA.

    @ SGBM

    I cannot seem to get youtube working with TOR. (Adobe playing silly again?) I might have to roll back to the previous version.

  477. says

    @ John Morales

    They could also be facing each other….!

    (cicely and blf to stop reading now.)

    From Othello:

    IAGO
    ‘Zounds, sir, you are one of those that will not
    serve God, if the devil bid you. Because we come to
    do you service and you think we are ruffians, you’ll
    have your daughter covered with a Barbary horse;
    you’ll have your nephews neigh to you; you’ll have
    coursers for cousins and gennets for germans.

    BRABANTIO
    What profane wretch art thou?

    IAGO
    I am one, sir, that comes to tell you your daughter
    and the Moor are now making the beast with two backs.

    BRABANTIO
    Thou art a villain.

    IAGO
    You are–a senator.

  478. John Morales says

    theophontes, is it synchronicity, or have you been reading B&W? ;)

    —

    Also, the beast with two backs can rearrange itself to have one front and one back.

    (Or so I’ve heard)

  479. says

    @ John Morales

    syncronicity or B&W


    Rupert Sheldrake     Syncronicity (I did not read her posts prior to posting. I count 4 posts on the opening screen of B&W that relate somehow to my comment above. Wow.)

  481. strange gods before me ॐ says

    theophontes,

    I cannot seem to get youtube working

    My first guess is NoScript. Gently wiggle some knobs.

    Otherwise, type about:plugins into Firefox’s address bar to see if Flash is being recognized. If not, you might have to install a copy of Flash into the bundle. I don’t know, I’m just guessing. (You may want to set about:config plugin.expose_full_path to true.)

    In any case, you can use youtube-dl to grab videos — remember to chmod u+x ./youtube-dl — and then watch them in VLC. So for instance you might do:

    env http_proxy=http://127.0.0.1:8118 HTTP_PROXY=http://127.0.0.1:8118 ./youtube-dl --format 34 http://www.youtube.com/watch?v=Cam2kK7J_8k

    I might have to roll back to the previous version.

    Next password will have to be less cute, more random.

    By the way, if I were you, I would not mention tee oh arr, lest Pharyngula be blacklisted. There’s a reason you already can’t download the bundle without outside assistance.

  483. Owlmirror says

    By the way, if I were you, I would not mention tee oh arr, lest Pharyngula be blacklisted. There’s a reason you already can’t download the bundle without outside assistance.

    Huh.

    Is the SF site with that name blacklisted? The site for the SF imprint of Macmillan Publishers USA?

  495. says

    @ Dhorvath

    Page two is a most wonderfull place, it is like Teh Thunderdome, only more so. It has endless herds of trolls and godbots scampering across the open veld, like so many gazelle on the Serangeti. There are pencil sharpeners under every tree and pointed sticks lie about, too many to count. The rivers are made of lemonade and the piggies roam about ready cooked, with knifes and forks stuck in theirrumps for easy slicing ….

  496. says

    @ Dhorvath

    Page two is a most wonderfull place, it is like Teh Thunderdome, only more so. It has endless herds of trolls and godbots scampering across the open veld, like so many gazelle on the Serangeti. There are pencil sharpeners under every tree and pointed sticks lie about, too many to count. The rivers are made of lemonade and the piggies roam about ready cooked, with knifes and forks stuck in their rumps for easy slicing ….